Molecular Vision[JOURNAL]
Sun
200 papers
mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.
Xu J, Zheng Y, Cheng L … +4 more , Sun H, Yu X, Gu F, Song E
Mol Vis · 2023 · PMID 38222445
PURPOSE: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. is the causative gene of ocular albinism...
PURPOSE: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. METHODS: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of . Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. RESULTS: Genetic analysis identified 11 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a mutation were found to present a typical or atypical phenotype of OA1. All patients with mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. CONCLUSIONS: We discovered seven novel mutations and four previously reported mutations of in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.
The impact of early RPE cell junction loss on VEGF, Ang-2, and TIMP secretion in vitro.
Paterson C, Cannon J, Vargis E
Mol Vis · 2023 · PMID 37859808
PURPOSE: The retinal pigment epithelium (RPE) is an important tissue for maintaining a healthy retina. Retinal pigment epithelial cells help regulate nutrient transport to photoreceptors and are heavily pigmented to prev...
PURPOSE: The retinal pigment epithelium (RPE) is an important tissue for maintaining a healthy retina. Retinal pigment epithelial cells help regulate nutrient transport to photoreceptors and are heavily pigmented to prevent light scattering. These cells also have junction proteins to form monolayers. Monolayers are key players in pathologies such as age-related macular degeneration (AMD), a leading cause of vision loss in older adults. During AMD, RPE cell detachment can occur, resulting in a loss of junctions. Losing junctions can increase the expression of pro-angiogenic vascular endothelial growth factor (VEGF). This overexpression can cause abnormal blood vessel growth or angiogenesis in the retina. Age-related macular degeneration treatments target VEGF to slow angiogenesis progression. However, other proteins, such as angiopoietin-2 (Ang-2) and the tissue inhibitor of metalloproteinase-1 (TIMP-1), may also play important roles, making them potential targets for treatment. Controlling RPE junction formation will help elucidate the relationship between RPE cell detachment and additional angiogenic factor secretion, lead to more therapeutics, and increase the efficacy of current treatments. METHODS: Micropatterning was used to control the spatial arrangement of primary porcine RPE cells using polydimethylsiloxane (PDMS) stencils. Patterns were formed into PDMS stencils to mimic 10%, 25%, and 50% overall detachment of the RPE monolayer. Zonula-occludens-1 (ZO-1), Ang-2, and VEGF were visualized using immunocytochemical (ICC) staining. An enzyme-linked immunosorbent assay (ELISA) was used to quantify extracellular Ang-2, VEGF, TIMP-1, and TIMP-2 levels. A rod outer segment (OS) phagocytosis assay was performed to determine how RPE junction loss directly affects photoreceptor support. RESULTS: The growth of primary porcine RPE cells was successfully controlled using stencils. Morphological changes and a decrease in pigmentation were observed, showing a decline in barrier and light absorption functions as degeneration increased. One day after stencil removal, junction proteins were delocalized, and angiogenic factor secretions were correlated with increased levels of detachment. Secretion levels of Ang-2 and TIMP-1 were significantly increased, whereas VEGF and TIMP-2 concentrations were not as affected by varying levels of detachment. OS phagocytosis appeared lower in RPE cells when ZO-1 was affected. CONCLUSIONS: These results suggest a correlation between loss of junctions, abnormal angiogenic protein secretion, and reduced OS phagocytosis. Furthermore, Ang-2 and TIMP-1 proteins might be beneficial targets for AMD treatments, and their roles in retinal diseases deserve further investigation.
PET imaging of retinal inflammation in mice exposed to blue light using [F]-DPA-714.
Chen Y, Zhou Y, Zhu X … +5 more , Yan G, Pan D, Wang L, Yang M, Wang K
Mol Vis · 2023 · PMID 37859807
PURPOSE: Positron emission tomography (PET) is widely used in high-precision imaging, which may provide a simple and noninvasive method for the detection of pathology and therapeutic effects. [F]-DPA-714 is a second-gene...
PURPOSE: Positron emission tomography (PET) is widely used in high-precision imaging, which may provide a simple and noninvasive method for the detection of pathology and therapeutic effects. [F]-DPA-714 is a second-generation translocator protein (TSPO) positron emission tomography radiotracer that shows great promise in a model of neuroinflammation. In this study, [F]-DPA-714 micro-PET imaging was used to evaluate retinal inflammation in mice exposed to blue light, a well-established model of age-related macular degeneration (AMD) for molecular mechanism research and drug screening. METHODS: C57BL/6J melanized mice were subjected to 10,000, 15,000, and 20,000 lux blue light for 5 days (8 h/day) to develop the retinal injury model, and the structure and function of the retina were assessed using hematoxylin-eosin (HE) staining, electroretinography (ERG), and terminal-deoxynucleotidyl transferase (TdT)-mediated nick-end labeling (TUNEL) immunostaining. Then, [F]-DPA-714 was injected approximately 100 μCi through each tail vein, and static imaging was performed 1 h after injection. Finally, the mice eyeballs were collected for biodistribution and immune analysis. RESULTS: The blue light exposure significantly destroyed the structure and function of the retina, and the uptake of [F]-DPA-714 in the retinas of the mice exposed to blue light were the most significantly upregulated, which was consistent with the biodistribution data. In addition, the immunohistochemical, western blot, and immunofluorescence data showed an increase in microglial TSPO expression. CONCLUSIONS: [F]-DPA-714 micro-PET imaging might be a good method for evaluating early inflammatory status during retinal pathology.
Collagen crosslinking impacts stromal wound healing and haze formation in a rabbit phototherapeutic keratectomy model.
Moore BA, Jalilian I, Kim S … +9 more , Mizutani M, Mukai M, Chang C, Entringer AM, Dhamodaran K, Raghunathan VK, Teixeira LBC, Murphy CJ, Thomasy SM
Mol Vis · 2023 · PMID 37859806
PURPOSE: The purpose of this study was to evaluate the elastic modulus, keratocyte-fibroblast-myocyte transformation, and haze formation of the corneal stroma following combined phototherapeutic keratectomy (PTK) and epi...
PURPOSE: The purpose of this study was to evaluate the elastic modulus, keratocyte-fibroblast-myocyte transformation, and haze formation of the corneal stroma following combined phototherapeutic keratectomy (PTK) and epithelium-off UV-A/riboflavin corneal collagen crosslinking (CXL) using an in vivo rabbit model. METHODS: Rabbits underwent PTK and CXL, PTK only, or CXL 35 days before PTK. Rebound tonometry, Fourier-domain optical coherence tomography, and ultrasound pachymetry were performed on days 7, 14, 21, 42, 70, and 90 post-operatively. Atomic force microscopy, histologic inflammation, and immunohistochemistry for α-smooth muscle actin (α-SMA) were assessed post-mortem. RESULTS: Stromal haze formation following simultaneous PTK and CXL was significantly greater than in corneas that received PTK only and persisted for more than 90 days. No significant difference in stromal haze was noted between groups receiving simultaneous CXL and PTK and those receiving CXL before PTK. Stromal inflammation did not differ between groups at any time point, although the intensity of α-SMA over the number of nuclei was significantly greater at day 21 between groups receiving simultaneous CXL and PTK and those receiving CXL before PTK. The elastic modulus was significantly greater in corneas receiving simultaneous CXL and PTK compared with those receiving PTK alone. CONCLUSIONS: We showed that stromal haze formation and stromal stiffness is significantly increased following CXL, regardless of whether it is performed at or before the time of PTK. Further knowledge of the biophysical cues involved in determining corneal wound healing duration and outcomes will be important for understanding scarring following CXL and for the development of improved therapeutic options.
mutational spectrum causing syndromic and non-syndromic retinal dystrophies in a large cohort of Mexican patients.
Ordoñez-Labastida V, Chacon-Camacho OF, Lopez-Rodriguez VR … +1 more , Zenteno JC
Mol Vis · 2023 · PMID 37287646
BACKGROUND: Mutations in the gene are the leading cause of both non-syndromic autosomal recessive retinitis pigmentosa (RP) and Usher syndrome, a syndromic form of RP characterized by retinal dystrophy and sensorineural...
BACKGROUND: Mutations in the gene are the leading cause of both non-syndromic autosomal recessive retinitis pigmentosa (RP) and Usher syndrome, a syndromic form of RP characterized by retinal dystrophy and sensorineural hearing loss. To contribute to the expansion of the -related molecular spectrum, the results of genetic screening in a large cohort of Mexican patients are presented. METHODS: The study population comprised 61 patients with a clinical diagnosis of either non-syndromic RP (n = 30) or Usher syndrome type 2 (USH2; n = 31) who were demonstrated to carry biallelic pathogenic variants in in a three-year period. Genetic screening was performed either by gene panel sequencing or by exome sequencing. A total of 72 available first- or second-degree relatives were also genotyped for familial segregation of the identified variants. RESULTS: The mutational spectrum in RP patients included 39 distinct pathogenic variants, most of them of the missense type. The most common RP-causing variants were p.Cys759Phe (c.2276G>T), p.Glu767Serfs*21 (c.2299delG), and p.Cys319Tyr (c.956G>A), which together accounted for 25% of all RP variants. Novel mutations included three nonsense, two missense, two frameshift, and one intragenic deletion. The mutational spectrum in USH2 patients included 26 distinct pathogenic variants, most of them of the nonsense and frameshift types. The most common Usher syndrome-causing variants were p.Glu767Serfs*21 (c.2299delG), p.Arg334Trp (c.1000C>T), and c.12067-2A>G), which together accounted for 42% of all USH2-related variants. Novel Usher syndrome mutations included six nonsense, four frameshift, and two missense mutations. The c.2299delG mutation was associated with a common haplotype for SNPs located in exons 2-21 of , indicating a founder mutation effect. CONCLUSIONS: Our work expands the mutational profile by identifying 20 novel pathogenic variants causing syndromic and non-syndromic retinal dystrophy. The prevalent c.2299delG allele is shown to arise from a founder effect. Our results emphasize the usefulness of molecular screening in underrepresented populations for a better characterization of the molecular spectrum of common monogenic diseases.
Genetic causes of inherited retinal diseases among Israeli Jews of Ethiopian ancestry.
Ben Yosef T, Banin E, Chervinsky E … +18 more , Shalev SA, Leibu R, Mezer E, Rotenstreich Y, Goldenberg-Cohen N, Weiss S, Khan MI, Panneman DM, Hitti-Malin RJ, Weiner C, Roosing S, Cremers FPM, Pras E, Zur D, Newman H, Deitch I, Sharon D, Ehrenberg M
Mol Vis · 2023 · PMID 37287645
PURPOSE: This study sought to describe the phenotype frequency and genetic basis of inherited retinal diseases (IRDs) among a nationwide cohort of Israeli Jewish patients of Ethiopian ancestry. METHODS: Patients' data-in...
PURPOSE: This study sought to describe the phenotype frequency and genetic basis of inherited retinal diseases (IRDs) among a nationwide cohort of Israeli Jewish patients of Ethiopian ancestry. METHODS: Patients' data-including demographic, clinical, and genetic information-were obtained through members of the Israeli Inherited Retinal Disease Consortium (IIRDC). Genetic analysis was performed by either Sanger sequencing for founder mutations or next-generation sequencing (targeted next-generation sequencing or whole-exome sequencing). RESULTS: Forty-two patients (58% female) from 36 families were included, and their ages ranged from one year to 82 years. Their most common phenotypes were Stargardt disease (36%) and nonsyndromic retinitis pigmentosa (33%), while their most common mode of inheritance was autosomal recessive inheritance. Genetic diagnoses were ascertained for 72% of genetically analyzed patients. The most frequent gene involved was . Overall, 16 distinct IRD mutations were identified, nine of which are novel. One of them, -c.6077delT, is likely a founder mutation among the studied population. CONCLUSIONS: This study is the first to describe IRDs' phenotypic and molecular characteristics in the Ethiopian Jewish community. Most of the identified variants are rare. Our findings can help caregivers with clinical and molecular diagnosis and, we hope, enable adequate therapy in the near future.
Encephalopsin (OPN3) is required for normal refractive development and the GO/GROW response to induced myopia.
Linne C, Mon KY, D'Souza S … +9 more , Jeong H, Jiang X, Brown DM, Zhang K, Vemaraju S, Tsubota K, Kurihara T, Pardue MT, Lang RA
Mol Vis · 2023 · PMID 37287644
PURPOSE: Myopia, or nearsightedness, is the most common form of refractive error and is increasing in prevalence. While significant efforts have been made to identify genetic variants that predispose individuals to myopi...
PURPOSE: Myopia, or nearsightedness, is the most common form of refractive error and is increasing in prevalence. While significant efforts have been made to identify genetic variants that predispose individuals to myopia, these variants are believed to account for only a small portion of the myopia prevalence, leading to a feedback theory of emmetropization, which depends on the active perception of environmental visual cues. Consequently, there has been renewed interest in studying myopia in the context of light perception, beginning with the opsin family of G-protein coupled receptors (GPCRs). Refractive phenotypes have been characterized in every opsin signaling pathway studied, leaving only Opsin 3 (OPN3), the most widely expressed and blue-light sensing noncanonical opsin, to be investigated for function in the eye and refraction. METHODS: expression was assessed in various ocular tissues using an Opn3eGFP reporter. Weekly refractive development in retinal and germline mutants from 3 to 9 weeks of age was measured using an infrared photorefractor and spectral domain optical coherence tomography (SD-OCT). Susceptibility to lens-induced myopia was then assessed using skull-mounted goggles with a -30 diopter experimental and a 0 diopter control lens. Mouse eye biometry was similarly tracked from 3 to 6 weeks. A myopia gene expression signature was assessed 24 h after lens induction for germline mutants to further assess myopia-induced changes. RESULTS: was found to be expressed in a subset of retinal ganglion cells and a limited number of choroidal cells. Based on an assessment of mutants, the OPN3 germline, but not retina conditional knockout, exhibits a refractive myopia phenotype, which manifests in decreased lens thickness, shallower aqueous compartment depth, and shorter axial length, atypical of traditional axial myopias. Despite the short axial length, null eyes demonstrate normal axial elongation in response to myopia induction and mild changes in choroidal thinning and myopic shift, suggesting that susceptibility to lens-induced myopia is largely unchanged. Additionally, the null retinal gene expression signature in response to induced myopia after 24 h is distinct, with opposing , , and polarity compared to controls. CONCLUSIONS: The data suggest that an OPN3 expression domain outside the retina can control lens shape and thus the refractive performance of the eye. Prior to this study, the role of in the eye had not been investigated. This work adds OPN3 to the list of opsin family GPCRs that are implicated in emmetropization and myopia. Further, the work to exclude retinal OPN3 as the contributing domain in this refractive phenotype is unique and suggests a distinct mechanism when compared to other opsins.
Basement membrane regeneration and TGF-β1 expression in rabbits with corneal perforating injury.
Meng N, Wu J, Chen J … +3 more , Luo Y, Xu L, Li X
Mol Vis · 2023 · PMID 37287643
PURPOSE: To evaluate the relationship between basement membrane (BM) regeneration and the spatiotemporal expression of TGF-β1 during wound healing in rabbits with corneal perforating injury. METHODS: Forty-two rabbits we...
PURPOSE: To evaluate the relationship between basement membrane (BM) regeneration and the spatiotemporal expression of TGF-β1 during wound healing in rabbits with corneal perforating injury. METHODS: Forty-two rabbits were randomly allocated into 7 experimental groups, with 6 rabbits per group at each time point. The central cornea of the left eye was injured with 2.0 mm trephine to establish the perforating injury model. Six rabbits that received no treatment were used as controls. The cornea was evaluated at 3 days, 1-3 weeks, and 1-3 months after injury with a slit lamp for haze levels. Real-time quantitative polymerase chain reaction (qRT-PCR) was performed to quantify the relative expression of TGF-β1 and α-SMA mRNA. Immunofluorescence (IF) was used to assess TGF-β1 and alpha-smooth actin (α-SMA) expression and localization. BM regeneration was assessed using transmission electron microscopy (TEM). RESULTS: After injury, dense haze appeared at 1 month and then gradually faded. The relative expression of TGF-β1 mRNA peaked at 1 week and then decreased until 2 months. The relative α-SMA mRNA expression reached its peak at 1 week, then reached a small peak again at 1 month. IF results showed that TGF-β1 was initially detected in the fibrin clot at 3 days and then in the entire repairing stroma at 1 week. TGF-β1 localization gradually diminished from the anterior region to the posterior region at 2 weeks to 1 month, and it was nearly absent at 2 months. The myofibroblast marker α-SMA was observed in the entire healing stroma at 2 weeks. Localization of α-SMA gradually disappeared from the anterior region at 3 weeks to 1 month, remaining only in the posterior region at 2 months and disappearing at 3 months. Defective epithelial basement membrane (EBM) was first detected at 3 weeks after injury, then gradually repaired, and was nearly regenerated at 3 months. A thin and uneven Descemet's membrane (DM) was initially detected at 2 months after injury, then gradually regenerated to some extent, but remained abnormal at 3 months. CONCLUSIONS: In the rabbit corneal perforating injury model, EBM regeneration was observed earlier than DM. At 3 months, complete EBM regeneration was observed, while the regenerated DM was still defective. TGF-β1 was distributed throughout the entire wound area in the early stages and then decreased from the anterior to the posterior region. α-SMA exhibited a similar temporospatial expression to TGF-β1. EBM regeneration may play a key role in low expression of TGF-β1 and α-SMA in the anterior stroma. Meanwhile, incomplete DM regeneration may contribute to the sustained expression of TGF-β1 and α-SMA in the posterior stroma.
The retina-specific basigin isoform does not induce IL-6 expression in mouse monocytes.
Solstad AD, Brown JM, Ochrietor JD
Mol Vis · 2023 · PMID 37287642
PURPOSE: Basigin gene products are positioned on adjacent cell types in the neural retina and are thought to compose a lactate metabolon important for photoreceptor cell function. The Ig0 domain of basigin isoform 1 (bas...
PURPOSE: Basigin gene products are positioned on adjacent cell types in the neural retina and are thought to compose a lactate metabolon important for photoreceptor cell function. The Ig0 domain of basigin isoform 1 (basigin-1) is highly conserved throughout evolution, which suggests a conserved function. It has been suggested that the Ig0 domain has proinflammatory properties, and it is hypothesized to interact with basigin isoform 2 (basigin-2) for cell adhesion and lactate metabolon formation. Therefore, the purpose of the present study was to determine whether the Ig0 domain of basigin-1 binds to basigin-2 and whether the region of the domain used for binding is also used to stimulate interleukin-6 (IL-6) expression. METHODS: Binding was assessed using recombinant proteins corresponding to the Ig0 domain of basigin-1 and endogenously expressed basigin-2 from mouse neural retina and brain protein lysates. The proinflammatory properties of the Ig0 domain were analyzed with exposure of the recombinant proteins to the mouse monocyte RAW 264.7 cell line and subsequent measurement of the IL-6 concentration in the culture medium via enzyme-linked immunosorbent assay (ELISA). RESULTS: The data indicate that the Ig0 domain interacts with basigin-2 through a region within the amino half of the domain and that the Ig0 domain does not stimulate the expression of IL-6 in mouse cells in vitro. CONCLUSIONS: The Ig0 domain of basigin-1 binds to basigin-2 in vitro. In addition, contrary to previous reports, there was no evidence that the Ig0 domain potentiates IL-6 expression in a mouse monocyte cell line in vitro. However, it is possible that the Ig0 domain stimulates the expression of proinflammatory cytokines other than IL-6, or that the potential involvement of the Ig0 domain of basigin-1 in the acute inflammatory response is dependent on species.
Identification of a novel partial deletion of associated with pre-Descemet corneal dystrophy and X-linked ichthyosis.
Williams D, Onyia O, Chung DD … +5 more , Kirakosyan A, Hovakimyan A, Payne C, Moshirfar M, Aldave AJ
Mol Vis · 2023 · PMID 37287641
PURPOSE: Pre-Descemet corneal dystrophy (PDCD) with X-linked ichthyosis (XLI) is associated with mutations in or deletions of the steroid sulfatase gene (). As only three cases of genetically confirmed PDCD associated wi...
PURPOSE: Pre-Descemet corneal dystrophy (PDCD) with X-linked ichthyosis (XLI) is associated with mutations in or deletions of the steroid sulfatase gene (). As only three cases of genetically confirmed PDCD associated with XLI have been reported, we sought to expand our understanding of the genetic basis of PDCD by screening in two previously unreported families. MATERIALS AND METHODS: The affected individuals underwent cutaneous and slit-lamp examinations. Saliva samples collected from each affected individual served as a source of DNA for the amplification of the 10 coding exons of and flanking DNA markers. RESULTS: The slit-lamp examination of three affected men (two of whom were brothers) from two families revealed bilateral punctate posterior corneal stromal opacities anterior to the Descemet membrane. Cutaneous examination demonstrated dry, coarse, scaly ichthyotic changes characteristic of XLI in all individuals. Genetic examination of the locus on the X chromosome in Case 1 revealed a deletion that spanned across DNA markers DXS1130-DXS237, which includes all the coding exons (exons 1-10) of . Genetic screening of Cases 2 and 3 revealed a partial deletion of the locus involving exons 1-7 and flanking DNA marker DXS1130 on the X chromosome. CONCLUSIONS: PDCD with XLI may be associated with either partial or complete deletion of . Despite the identification of point mutations, partial deletion, and complete deletion of in different affected families reported to date, there was no apparent difference in the affected phenotype between the families, suggesting that the identified variants likely all resulted in loss of function of steroid sulfatase.
Corneal epithelial basement membrane assembly is mediated by epithelial cells in coordination with corneal fibroblasts during wound healing.
Shiju TM, Sampaio LP, Hilgert GSL … +1 more , Wilson SE
Mol Vis · 2023 · PMID 37287640
PURPOSE: To understand which cell types, either alone or in combination, contribute to the assembly of the epithelial basement membrane (BM) during corneal wound healing. METHODS: A 3D corneal organotypic model and an in...
PURPOSE: To understand which cell types, either alone or in combination, contribute to the assembly of the epithelial basement membrane (BM) during corneal wound healing. METHODS: A 3D corneal organotypic model and an in situ rabbit photorefractive keratectomy (PRK) model were used in this study. The 3D corneal organotypic model was established by culturing the rabbit corneal epithelial cells with either corneal fibroblasts or myofibroblasts embedded in collagen type I for 18 days. Corneal fibroblasts were isolated from fresh rabbit corneas, and the myofibroblasts were derived either directly from bone marrow or differentiated from corneal fibroblasts. Immunocytochemistry for alpha-smooth muscle actin (SMA), vimentin, desmin, and vinculin markers confirmed well-differentiated myofibroblasts. Immunohistochemistry was performed in cryofixed sections for BM markers, including laminin alpha-5, laminin beta-3, perlecan, nidogen-1, and collagen type IV. Specimens were also examined with transmission electron microscopy (TEM). Corneas were collected from rabbits after -3 diopter (D) PRK at different time points after surgery, with four corneas at each time point in each group. Cryofixed corneal sections were stained for vimentin, alpha-SMA, and nidogen-1. RESULTS: The formation of an epithelial BM with expression of laminin alpha-5, laminin beta-3, perlecan, nidogen-1, and collagen IV was observed at the interface between the corneal epithelial cells and corneal fibroblasts. TEM images further confirmed the presence of epithelial BM in organotypic cultures of epithelial cells and corneal fibroblasts. No epithelial BM was observed in cultures of corneal epithelial cells and myofibroblasts (cornea or bone marrow derived), corneal epithelial cells alone, or corneal fibroblasts alone. In rabbit corneas after -3D PRK, a strong association was observed between the regenerating epithelial BM and the presence of corneal fibroblasts at the site of epithelial BM generation. CONCLUSIONS: The corneal epithelial BM assembly is mediated by epithelial cells in coordination with corneal fibroblasts during wound healing.
Efficacy of sodium polyanethol sulfonate on herpes simplex virus-1 infection in vitro.
Li J, Cheng C, Lin T … +3 more , Xue R, Liu X, Wu K
Mol Vis · 2022 · PMID 37089702
UNLABELLED: Objective: To investigate the effect of sodium polyanethol sulfonate (SPS) on herpes simplex virus type 1 (HSV-1) infection in vitro. METHODS: Human corneal epithelial (HCE-T) cells and Vero cells were infect...
UNLABELLED: Objective: To investigate the effect of sodium polyanethol sulfonate (SPS) on herpes simplex virus type 1 (HSV-1) infection in vitro. METHODS: Human corneal epithelial (HCE-T) cells and Vero cells were infected with HSV-1 [HSV-1 f strain, HSV-1f; HSV-1-H129 with green fluorescent protein (GFP) knock-in, HSV-1g]. SPS was added to the culture medium at various concentrations in time-of-addition assay. Experiments including photography of fluorescence in HSV-1g or plaque formation by HSV-1f, western blot assays, real-time RT-PCR assays, cytopathic effect inhibition assays, cytotoxicity assays, and viral absorption and penetration assays were performed to explore the antiviral effect and mechanism of the compounds. RESULTS: We identified that SPS reduced the replication of HSV-1 in HCE-T and Vero cells in a dose-dependent manner. HSV-1g fluorescence was reduced by 66.3% and 65.4% in HCE-T and Vero cells, respectively, after treatment with 0.4 µg/ml SPS. Furthermore, the viral fluorescence intensities were inhibited by SPS in a dose-dependent manner when the viruses or cells were preincubated with SPS. Relative levels of the ICP4 protein and VP16 mRNA were decreased by SPS in a dose-dependent manner. Moreover, the IC values of SPS for HSV-1g and HSV-1f in HCE-T cells were 0.69±0.09 μg/ml and 1.63±0.44 μg/ml, respectively. Even 10,000 µg/ml SPS had no obvious cytotoxicity toward HCE-T and Vero cells. Importantly, viral absorption and penetration assays showed that the relative fluorescence intensity of HSV-1g was significantly reduced by SPS in a dose-dependent manner in the absorption test, but no change was observed in the penetration test. CONCLUSIONS: SPS inhibits HSV-1 replication in HCE-T and Vero cells, indicating that SPS has the potential for treating HSV-1 infection, particularly HSV-1 keratitis.
Epac1 and PKA agonists inhibit ROS to reduce NLRP3 inflammasome proteins in retinal endothelial cells.
Liu L, Jiang Y, Steinle JJ
Mol Vis · 2022 · PMID 37089701
PURPOSE: Reactive oxygen species (ROS) activate inflammatory pathways in several organs, including the retina. More recent work has shown that ROS activate the NOD-like receptor protein 3 (NLRP3) inflammasome pathway pro...
PURPOSE: Reactive oxygen species (ROS) activate inflammatory pathways in several organs, including the retina. More recent work has shown that ROS activate the NOD-like receptor protein 3 (NLRP3) inflammasome pathway proteins. We recently showed that the exchange protein activated by cAMP 1 (Epac1) and protein kinase A (PKA) regulates NLRP3 proteins in the retina. Our goal was to determine whether Epac1 and PKA reduce ROS and NLRP3 inflammasome proteins. METHODS: We used human primary retinal endothelial cells (RECs) grown in normal glucose (5 mM) and stimulated in normal glucose with hydrogen peroxide (HO) to induce ROS and measured NLRP3 pathway proteins. In some groups, we treated cells with an Epac1 or a PKA agonist in addition to HO treatment to determine whether Epac1 and PKA reduced ROS and induced NLRP3 pathway proteins. RESULTS: The data showed that 500 µM HO was the optimal dose to increase ROS in RECs. In RECs treated with HO, NLRP3 pathway proteins were increased, which were significantly reduced by cotreatment with PKA or Epac1 agonists. HO significantly increased NIMA-related kinase 7 (Nek7) and purinergic 2X7 receptor 7 (P2X7) levels, which were blocked by Epac1 and PKA agonists. CONCLUSIONS: Taken together, these data suggest that Epac1 and PKA reduce retinal inflammation through the reduced ROS-induced activation of NLRP3 pathway proteins.
PET imaging of retinal inflammation in mice exposed to blue light using [F]-DPA-714.
Chen Y, Zhou Y, Zhu X … +5 more , Yan G, Pan D, Wang L, Yang M, Wang K
Mol Vis · 2022 · PMID 37089700
PURPOSE: Positron emission tomography (PET) is widely used in high-precision imaging, which may provide a simple and noninvasive method for the detection of pathology and therapeutic effects. [F]-DPA-714 is a second-gene...
PURPOSE: Positron emission tomography (PET) is widely used in high-precision imaging, which may provide a simple and noninvasive method for the detection of pathology and therapeutic effects. [F]-DPA-714 is a second-generation translocator protein (TSPO) positron emission tomography radiotracer that shows great promise in a model of neuroinflammation. In this study, [F]-DPA-714 micro-PET imaging was used to evaluate retinal inflammation in mice exposed to blue light, a well-established model of age-related macular degeneration (AMD) for molecular mechanism research and drug screening. METHODS: C57BL/6J melanized mice were subjected to 10,000, 15,000, and 20,000 lux blue light for 5 days (8 h/day) to develop the retinal injury model, and the structure and function of the retina were assessed using hematoxylin-eosin (HE) staining, electroretinography (ERG), and terminal-deoxynucleotidyl transferase (TdT)-mediated nick-end labeling (TUNEL) immunostaining. Then, [F]-DPA-714 was injected approximately 100 μCi through each tail vein, and static imaging was performed 1 h after injection. Finally, the mice eyeballs were collected for biodistribution and immune analysis. RESULTS: The blue light exposure significantly destroyed the structure and function of the retina, and the uptake of [F]-DPA-714 in the retinas of the mice exposed to blue light were the most significantly upregulated, which was consistent with the biodistribution data. In addition, the immunohistochemical, western blot, and immunofluorescence data showed an increase in microglial TSPO expression. CONCLUSIONS: [F]-DPA-714 micro-PET imaging might be a good method for evaluating early inflammatory status during retinal pathology.
Novel segmentation algorithm for high-throughput analysis of spectral domain-optical coherence tomography imaging of teleost retinas.
Barter KR, Paradis H, Gendron RL … +2 more , Vidal JAL, Meruvia-Pastor O
Mol Vis · 2022 · PMID 37089699
Spectral domain-optical coherence tomography (SD-OCT) has become an essential tool for assessing ocular tissues in live subjects and conducting research on ocular development, health, and disease. The processing of SD-OC...
Spectral domain-optical coherence tomography (SD-OCT) has become an essential tool for assessing ocular tissues in live subjects and conducting research on ocular development, health, and disease. The processing of SD-OCT images, particularly those from non-mammalian species, is a labor-intensive manual process due to a lack of automated analytical programs. This paper describes the development and implementation of a novel computer algorithm for the quantitative analysis of SD-OCT images of live teleost eyes. Automated segmentation processing of SD-OCT images of retinal layers was developed using a novel algorithm based on thresholding. The algorithm measures retinal thickness characteristics in a large volume of imaging data of teleost ocular structures in a short time, providing increased accuracy and repeatability of SD-OCT image analysis over manual measurements. The algorithm also generates hundreds of retinal thickness measurements per image for a large number of images for a given dataset. Meanwhile, heat mapping software that plots SD-OCT image measurements as a color gradient was also created. This software directly converts the measurements of each processed image to represent changes in thickness across the whole retinal scan. It also enables 2D and 3D visualization of retinal thickness across the scan, facilitating specimen comparison and localization of areas of interest. The study findings showed that the novel algorithm is more accurate, reliable, and repeatable than manual SD-OCT analysis. The adaptability of the algorithm makes it potentially suitable for analyzing SD-OCT scans of other non-mammalian species.
Chronic ocular sequelae in Stevens-Johnson syndrome: a genetic association study.
Sangwan SK, Sharma N, Agarwal T … +4 more , Khanna N, Pandey RM, Sharma A, Vajpayee RB
Mol Vis · 2022 · PMID 37089698
PURPOSE: This study sought to investigate the association of molecular markers with chronic ocular sequelae in Stevens-Johnson syndrome/toxic epidermal necrolysis (SJS/TEN). METHODS: One hundred SJS/TEN patients (200 eye...
PURPOSE: This study sought to investigate the association of molecular markers with chronic ocular sequelae in Stevens-Johnson syndrome/toxic epidermal necrolysis (SJS/TEN). METHODS: One hundred SJS/TEN patients (200 eyes) with confirmed diagnosis were enrolled between July 2011 and July 2015 from a tertiary eye-care hospital, and their clinical histories were noted. Each eye was scored for severity of manifestation on a scale of 0-5. Peripheral blood samples were collected for DNA followed by screening for interleukin (IL-4, IL-13, IL-4R) polymorphisms, HLA-A locus allele typing, and sera to detect levels of the apoptotic markers granulysin and sFas L. RESULTS: Of the 100 enrolled patients (53 males/47 females; age range: 6-58 years), the incriminating drugs were non-steroidal anti-inflammatory (52%), antibiotics (10%), sulphonamides (8%), anti-epileptics (6%), and unknown (24%). Significant differences in the frequencies of IL-4R polymorphism, HLA-A*3301, HLA-A*02, and HLA-A*2402 alleles, and elevated levels of granulysin and sFas L were observed in patients compared to controls. The ocular complications of conjunctival keratinization (p=0.004) showed an association with IL-13 promoter region (IL-13a) genotypes. CONCLUSIONS: The study highlights the possible association of interleukin-13 with severity-graded chronic sequelae and the role of HLA-A alleles- HLA-A*3301, HLA-A*02, and HLA-A*2402 in SJS/TEN causation and manifestation. Screening of these alleles may help caregivers to identify markers associated with severe and lifelong ocular complications, and help in appropriate treatment and management of the condition.
Whole exome sequencing revealed novel pathogenic variants in Vietnamese patients with FEVR.
Trang DT, Phu NM, Hung DM … +8 more , Nhung VP, Ha NN, Thuong MTH, Ngoc TTB, Hiep NX, Ton ND, Hai NV, Ha NH
Mol Vis · 2022 · PMID 37089697
BACKGROUND: Familial exudative vitreoretinopathy (FEVR) is a rare inherited disorder marked by incomplete retinal vascularization associated with exudation, neovascularization, and tractional retinal detachment. FEVR is...
BACKGROUND: Familial exudative vitreoretinopathy (FEVR) is a rare inherited disorder marked by incomplete retinal vascularization associated with exudation, neovascularization, and tractional retinal detachment. FEVR is genetically heterogeneous and is caused by variants in six genes: and In addition, the phenotypic overlap between FEVR and other disorders has been reported in patients harboring variants in other genes, such as , and . PURPOSE: To identify pathogenic variants in Vietnamese pediatric patients diagnosed with FEVR and to investigate the clinical findings in correlation with each causative gene. METHODS: A total of 20 probands underwent ocular examinations with fundoscopy (ophthalmoscopy) or fluorescein angiography. Genomic DNA was extracted from the peripheral blood of the probands and their family members. Multiplex ligation-dependent probe amplification (MLPA) was employed to detect copy number variants of FEVR-causing genes. Short variants were screened by whole-exome sequencing (WES) and then validated by Sanger sequencing. RESULTS: Fluorescein angiography showed retinal vascular anomalies in all patients. Other ocular abnormalities commonly found were strabismus, nystagmus, exudation, and retinal detachment. Genetic analysis identified 12 different variants in the , , and genes among 20 probands. Four variants were novel, including FZD4 c.169G>C, p.(G57R); NDP c.175-3A>G, splicing; KIF11 c.2146C>T, p.(Q716*) and c.2511_2515del, p.(N838Kfs*17). All patients with the variant showed signs of microcephaly and intellectual disability. The patient with Norrie syndrome and their family members were found to have a deletion of exon 2 in the gene. CONCLUSIONS: This study sheds light on the genetic causes of ocular disorders with the clinical expression of FEVR in Vietnamese patients. WES was applied as a comprehensive tool to identify pathogenic variants in complex diseases, such as FEVR, and the detection rate of pathogenic mutations was up to 60%.
Analysis of hemopexin plasma levels in patients with age-related macular degeneration.
Lauwen S, Bakker B, de Jong EK … +4 more , Fauser S, Hoyng CB, Lefeber DJ, den Hollander AI
Mol Vis · 2022 · PMID 37089696
PURPOSE: A protein quantitative trait locus (pQTL) analysis recently revealed a strong association between hemopexin (HPX) levels and genetic variants at the complement factor H () locus. In this study, we aimed to deter...
PURPOSE: A protein quantitative trait locus (pQTL) analysis recently revealed a strong association between hemopexin (HPX) levels and genetic variants at the complement factor H () locus. In this study, we aimed to determine HPX plasma levels in patients with age-related macular degeneration (AMD) and to compare them with those in controls. We also investigated whether genetic variants at the locus are associated with HPX plasma levels. METHODS: HPX levels were quantified in 200 advanced AMD cases and 200 controls using an enzyme-linked immunosorbent assay and compared between the two groups. Furthermore, HPX levels were analyzed per genotype group of three HPX-associated variants (rs61818956, rs10494745, and rs10801582) and four AMD-associated variants (rs794362 [proxy for rs187328863], rs570618, rs10922109, and rs61818924 [proxy for rs61818925]) at the locus. RESULTS: HPX levels were similar in the control group compared with the AMD group. The three variants at the locus, which were previously associated with the HPX levels, showed no association with the HPX levels in our data set. No significant differences in HPX levels were detected between the different genotype groups of AMD-associated variants at the locus. CONCLUSIONS: In this study, HPX levels were not associated with AMD or AMD-associated variants at the locus. The finding of a previous pQTL study that variants at the locus were associated with HPX levels was also not confirmed in this study.
Psychological stress induces moderate pathology in the ganglion cell layer in mice.
Zhang D, Sun N, Guo C … +7 more , Lee JH, Zhang J, Zhao Z, Yu X, Han Y, Ge J, Fan Z
Mol Vis · 2022 · PMID 36605831
PURPOSE: Primary open-angle glaucoma (POAG) is a condition with unclear pathogenesis. Researchers have observed an increased incidence of young Chinese POAG patients who manifest significant psychological stress while th...
PURPOSE: Primary open-angle glaucoma (POAG) is a condition with unclear pathogenesis. Researchers have observed an increased incidence of young Chinese POAG patients who manifest significant psychological stress while their intraocular pressure (IOP) is normal or close to normal; we hypothesize that psychological stress may play a causal role in initiating POAG. METHODS: Twenty-four male C57BL/6 mice were included and divided randomly into two groups. A chronic unpredictable mild stress (CUMS) mouse model was established to evaluate the effect of psychological stress on glaucoma-related retinal pathologies. Body weight and IOP were recorded weekly. At 5 weeks after the CUMS procedure, a behavior test, serum corticosterone level, retinal nerve fiber layer (RNFL) thickness, retinal ganglion cell (RGC) number and neurotrophic factor expression were evaluated and compared between the CUMS group and the control group. RESULTS: CUMS exposure induced depression-like behaviors, lighter body weight, and increased serum corticosterone levels in mice. RNFL thinning and neural cell loss in the ganglion cell layer (GCL) were observed in CUMS mice without significant IOP elevation. Decreased mRNA expression and protein levels of neurotropic factors in retinas of CUMS mice were observed, especially brain-derived neurotrophic factor (BDNF). CONCLUSIONS: The CUMS mouse model demonstrated that psychological stress induced glaucoma-like changes in the retinas of CUMS mice. The mechanism by which psychological stress induces retina defects may be due to a reduced expression of retinal neurotropic factors. Thus, we conclude that psychological stress is causally associated with POAG.
Safety evaluation and pharmacodynamics of minocycline hydrochloride eye drops.
Li X, Zhang W, Ye Z … +3 more , Pei S, Zheng D, Zhu L
Mol Vis · 2022 · PMID 36605830
PURPOSE: This study evaluated the safe dosage of minocycline hydrochloride (Mino) eye drops and investigated the potential for the prevention or reduction of retinal damage in a diabetic rat model. METHODS: Various conce...
PURPOSE: This study evaluated the safe dosage of minocycline hydrochloride (Mino) eye drops and investigated the potential for the prevention or reduction of retinal damage in a diabetic rat model. METHODS: Various concentrations of Mino were applied to human corneal epithelial cells (HCECs) to determine the half maximal inhibitory concentration (IC). The safety of Mino eye drops was evaluated on Sprague-Dawley (SD) rat eyes by slit-lamp examination, electroretinography (ERG), histology, and TUNEL assay. Eye drops (1 mg/ml) were applied to the streptozotocin-induced diabetic SD rats. Clinical observations, ERG analyses, and optical coherence tomography analyses were performed monthly for five months. Eyes were then analyzed via histology, blood-retinal barrier function assay, and retinal vascular staining. RESULTS: Cytotoxicity analysis using HCECs revealed that the IC was 250 µg/ml. Safety analyses in healthy SD rats showed that Mino eye drops did not demonstrate any ocular toxicity. Pharmacodynamics analysis showed that retinal thickness at three months was greater in the Mino group than in the non treated (NT) group. The peak times and amplitudes of each program were better in the Mino group than in the NT group at each time point by ERG analyses. Histology examinations showed a thinner ganglion cell layer, fewer ganglion cells, and more dilated blood vessels in the NT group than in the Mino group. CONCLUSION: Mino eye drops at 1 mg/ml were safe when used in SD rats. Mino eye drops can protect the retina from the development or progression of diabetic retinopathy.
About
- Frequency
- Sun
- Papers found
- 200
- RSS feed
- Subscribe