Searches / Journal Of Clinical Immunology[JOURNAL]

Journal Of Clinical Immunology[JOURNAL]

Sun 200 papers
RSS

Three Doses and Six Months Later: Real-World SARS-CoV-2 Specific Humoral and Cell-Mediated Immunity in Children With Inborn Errors of Immunity.

Porto LLTN, Yazji D, Unninayar D … +24 more , Decaluwe H, Derfalvi B, Palma A, Issekutz T, Kalashnikova T, Murguía-Favela L, Pham-Huy A, Rubin T, Suresh S, Upton J, Wright NAM, Chapdelaine H, Falcone EL, Top KA, Sadarangani M, Vinh DC, Barrett L, Oldford S, Langlois MA, Arnold C, Zhang T, Ramsay T, Cowan J, VISID study investigators

J Clin Immunol · 2026 Apr · PMID 42034835 · Full text

PURPOSE: To assess the durability of SARS-CoV-2-specific immunity following three doses of COVID-19 vaccine in children with inborn errors of immunity (IEI). METHODS: In this multi-center observational study, we compared... PURPOSE: To assess the durability of SARS-CoV-2-specific immunity following three doses of COVID-19 vaccine in children with inborn errors of immunity (IEI). METHODS: In this multi-center observational study, we compared SARS-CoV-2 specific humoral and T-cell immunity 24 weeks after the third dose of monovalent mRNA COVID-19 vaccine in children (5–18 years) with IEI and healthy controls (HC). Participants with IEI were categorized into predominant antibody deficiency (PAD) or non-PAD subgroups. RESULTS: Forty-three children with IEI (26 with PAD and 17 with non-PAD; 16 females, mean age 10.5 ± 4 years) and 12 HC (7 females, mean age 14.1 ± 3 years) were included. Anti-RBD IgG and anti-S IgG seropositivity was 100% in both groups. However, geometric mean concentrations (95% confidence interval) were significantly lower in IEI versus HC: 1,349.0 (905.4–2,009.9) vs. 3,324.2 (1,762.8–6,268.6) BAU/mL, p = 0.03 for anti-RBD IgG, and 1,336.4 (938.2 – 1,903.5) vs. 3,320.9 (2,158.4 – 5109.7), BAU/mL, p = 0.012 for anti-S IgG. Neutralizing antibody titers against ancestral and Omicron BA.1, BA.4/BA.5, and XBB.1.5 were also significantly lower in IEI, especially among PAD participants (p = 0.001). In contrast, S-specific T-cell responses did not differ significantly between IEI and HC. CONCLUSION: Six months after the third COVID-19 vaccine dose, children with IEI retained SARS-CoV-2-specific humoral and cellular immunity, though antibody responses were attenuated, particularly among PAD cases. Importantly, spike-specific T-cell responses were preserved and comparable to HC. These findings underscore that, in real-world settings, children with IEI maintain durable SARS-CoV-2-specific cellular immunity—including memory T-cell responses—highlighting the benefit of vaccination and the potential for continued immune protection despite impaired humoral responses.

Hematopoietic Stem Cell Transplantation Achieves Sustained Remission in Pediatric RAS-Associated Autoimmune Lymphoproliferative Disorder with Life-Threatening Complications: a Single-Center Case Series and Literature Review.

Lin Y, Qin X, Zhou C … +8 more , Yu U, Huang X, Wang X, Zhang M, Luo C, Luo C, Wang X, Chen J

J Clin Immunol · 2026 Apr · PMID 42026260 · Full text

UNLABELLED: RAS-associated autoimmune lymphoproliferative disorder (RALD) is a rare disease caused by somatic mutations in or genes and is characterized by hepatosplenomegaly, cytopenia, and autoimmune manifestations.... UNLABELLED: RAS-associated autoimmune lymphoproliferative disorder (RALD) is a rare disease caused by somatic mutations in or genes and is characterized by hepatosplenomegaly, cytopenia, and autoimmune manifestations. Current conventional therapies often yield only transient remission. Herein, we report three pediatric cases of refractory RALD that were successfully treated with allogeneic hematopoietic stem cell transplantation (HSCT). After 21 to 78 months of follow-up, all patients achieved complete recovery of hematopoietic and immune functions, suggesting cure. A concomitant review of the literature identified four additional published RALD cases treated with HSCT, all of whom were successfully rescued. Collectively, these cases expand the known clinical spectrum of RALD and provide preliminary evidence supporting HSCT as a potentially curative option for refractory disease. SUPPLEMENTARY INFORMATION: The online version contains supplementary material available at 10.1007/s10875-026-02022-0.

Translating Host-Derived Signals from Cerebrospinal Fluid Metagenomic Sequencing into a Diagnostic Tool for Autoimmune Encephalitis in Children.

Han D, Pan X, Pan F … +11 more , Han B, Wu Q, Zhou Y, Liu H, Xu H, Sun W, Cheng H, Liu W, Wan R, Weng W, Zhang H

J Clin Immunol · 2026 Apr · PMID 42018084 · Full text

BACKGROUND: The rapid differentiation between autoimmune and infectious encephalitis in children is a critical clinical decision that dramatically impacts treatment and outcome. Metagenomic next-generation sequencing (mN... BACKGROUND: The rapid differentiation between autoimmune and infectious encephalitis in children is a critical clinical decision that dramatically impacts treatment and outcome. Metagenomic next-generation sequencing (mNGS) of cerebrospinal fluid (CSF) is a powerful but often underutilized tool, as its host-derived RNA component is typically discarded. We hypothesized that this host response data could be translated into a diagnostic tool for autoimmune encephalitis (AE). METHODS: We enrolled 180 pediatric patients with suspected encephalitis to evaluate the clinical performance of CSF mNGS against conventional methods. Host transcriptomic analysis was performed on CSF cells from 88 patients (autoimmune, bacterial, and viral encephalitis). A novel biomarker was validated using RT-qPCR in an independent cohort, and its functional role was investigated in neuronal cultures challenged with NMDAR1 antibodies. A diagnostic model was developed and validated. RESULTS: mNGS demonstrated a significantly higher pathogen detection rate than conventional methods (29.4% vs. 16.7%). Host transcriptomic profiling revealed that AE shared a hyperinflammatory signature with viral encephalitis but was uniquely associated with dysregulation of receptor tyrosine kinase and heme signaling pathways. Furthermore, memory B cells and activated mast cells were specifically elevated in AE. We identified and validated RAD54B as a novel biomarker specifically upregulated in AE. Functionally, RAD54B upregulation protected neurons from DNA damage stress induced by NMDAR1 antibodies. A multi-gene diagnostic model based on host-response genes robustly differentiated AE from infectious encephalitis (AUC > 0.923) in a validation set. CONCLUSIONS: We present a validated translational pipeline that repurposes routine CSF mNGS data into a dual-purpose diagnostic tool. By leveraging the host RNA data inherent in CSF mNGS, clinicians can now simultaneously investigate infectious and autoimmune etiologies in a single, rapid test. This strategy has the immediate potential to reduce diagnostic delay, guide timely therapy, and improve outcomes in children with encephalitis.

Adult Onset of MSMD Caused by IL-12Rβ1 Variants: Report of a Young Woman with NTM Infection Lacking Bacille Calmette-Guérin (BCG)-induced Diseases.

Chen J, Xi M, Hu W … +5 more , He R, Zhang W, Zhang Y, Chen X, Chen J

J Clin Immunol · 2026 Apr · PMID 42012700 · Full text

Mendelian susceptibility to mycobacterial disease (MSMD) is characterized by increased susceptibility to infections caused by weakly virulent mycobacteria (such as nontuberculous mycobacteria (NTM) or the Bacillus Calmet... Mendelian susceptibility to mycobacterial disease (MSMD) is characterized by increased susceptibility to infections caused by weakly virulent mycobacteria (such as nontuberculous mycobacteria (NTM) or the Bacillus Calmette–Guérin (BCG) vaccine) in otherwise healthy individuals. In this study, we described a 29-year-old patient with MSMD due to NTM infection identified using metagenomic next-generation sequencing (mNGS) testing. The patient showed a poor response to standard antimycobacterial treatment. Therefore, we performed whole-exome sequencing (WES) and identified three heterozygous variants in IL-12Rβ1 (Ala131Thr, Arg323* and Arg561*). The two deleterious IL-12RB1 variants, Arg323* and Arg561*,were shown to be in trans (paternal and maternal, respectively). Further investigation revealed that two of these variants (Arg323* and Arg561*) could affect the binding between IL-12Rβ1 and IL-12Rβ2, leading to a weakened response of CD4+ T cells to stimulation with IL-12 plus tuberculosis antigen (TbAg), with reduced expression levels of IFN-γ and its downstream target p-STAT4. However, these variants did not affect the CD4+ T-cell response to glucan stimulation, as the three heterozygous variant loci do not interfere with the aggregation of IL-12Rβ1 and IL-23R. This autosomal recessive, partial IL-12Rβ1 deficiency ultimately resulted in the patient developing disseminated NTM infection. In clinical treatment, we combined IFN-γ with standard antimycobacterial therapy. The patient showed only a partial response to therapy. Therefore, as detection techniques continue to advance, it is important for clinicians to increase their understanding of MSMD to enable faster and more accurate diagnosis and treatment.

Antigen Microarray Reveals Broad and Subclinical Autoimmunity in Patients with Inborn Errors of Immunity.

Zhang W, Sun B, Wang W … +8 more , Zhu K, Wu Q, Liu L, Wang C, Xiao F, Zhou Q, Wang X, Sun J

J Clin Immunol · 2026 Apr · PMID 42012563 · Full text

PURPOSE: The inborn errors of immunity (IEIs) are a group of heterogeneous disorders. Although autoimmunity frequently coexists with IEIs, the manifestations vary greatly across different disorders. Most cases are recogn... PURPOSE: The inborn errors of immunity (IEIs) are a group of heterogeneous disorders. Although autoimmunity frequently coexists with IEIs, the manifestations vary greatly across different disorders. Most cases are recognized only after clinical symptoms emerge, impacting outcomes. However, limited research has been reported on how to achieve early identification. In this study, we aim to identify early or subclinical autoimmune reactivity and associated immunological patterns in patients with IEIs, and to explore differences among various IEI genotypes. METHODS: The clinical records and laboratory data of 26 patients were reviewed. Immunophenotypes were evaluated by multiparametric flow cytometry. Genetic findings were confirmed by whole-exome sequencing (WES). Autoantibodies were detected via antigen microarray analysis. RESULTS: We focused on several types of inborn errors of immunity that are prone to autoimmune diseases including 5 CD40LG mutations, 4 RAG1/2 mutations, 1 IL2RG mutation, 1 DOCK8 mutation, 1 SH2D1A mutation, 1 FAS mutation, 1 FOXP3 mutation, 1 TNFAIP3 mutation, 6 STAT3 gain-of-function (GOF) mutations, 3 STAT3 loss-of-function (LOF) mutations, and 2 CTLA4 mutations. Approximately 31% had clinical autoimmune manifestations, while several asymptomatic patients showed elevated autoantibodies. Some patients exhibited broad IgG and/or IgM autoantibody profiles targeting nuclear, cell membrane, and organ-specific antigens, which were associated with certain clinical features or immune subsets, such as increased double-negative T (DNT) cells and marginal zone B (MZB) cells. CONCLUSION: Antigen microarrays may enable early identification of autoimmune risk in IEI patients even before symptoms arise. Patients with genotypes such as STAT3 GOF were more likely to develop autoimmunity. The breadth of IgM autoantibodies correlated positively with MZB cell frequency, and higher DNT cell levels were significantly associated with clinical autoimmunity, suggesting potential utility for early risk stratification.

TREM-1-Associated Neutrophil Extracellular Trap Formation is Linked to IVIG Resistance in Kawasaki Disease: A Convergent Transcriptomic and Prospective Validation Study.

Wang S, Luo G, Ji Z … +1 more , Pan S

J Clin Immunol · 2026 Apr · PMID 42010185 · Full text

Kawasaki disease (KD) remains the leading cause of acquired heart disease in children. While intravenous immunoglobulin (IVIG) represents standard therapy, approximately 10-20% of patients exhibit treatment refractorines... Kawasaki disease (KD) remains the leading cause of acquired heart disease in children. While intravenous immunoglobulin (IVIG) represents standard therapy, approximately 10-20% of patients exhibit treatment refractoriness associated with significantly elevated coronary artery lesion risk. Current risk stratification relies on clinical parameters-fever duration or nonspecific inflammatory markers-which fail to capture distinct immunopathological features associated with treatment failure. To bridge this gap, we employed a convergent strategy integrating transcriptomic discovery from two independent cohorts with prospective protein-level and cellular validation in a clinical cohort. Three machine learning models-LASSO regression, Random Forest, and XGBoost-independently identified TREM1 (Triggering Receptor Expressed on Myeloid cells-1) as a core resistance predictor. Prospective validation in 117 KD patients demonstrated that plasma soluble TREM-1 (sTREM-1) was markedly elevated in IVIG-resistant cases (median 1247 vs. 856 pg/mL, P < 0.001) and effectively differentiated KD from other febrile illnesses. Mechanistically, sTREM-1 elevation showed a moderate positive correlation with myeloperoxidase-DNA complexes (ρ = 0.612, P < 0.001), indicating that TREM-1-associated neutrophil hyperactivation is associated with excessive neutrophil extracellular trap (NET) formation and vascular injury. External validation (GSE63881) confirmed TREM1 upregulation (2.1-fold) in resistant patients. Incorporating sTREM-1 into a multivariable prediction model achieved area under curve 0.884 using Firth's penalized logistic regression (optimism-corrected AUC 0.871) in this derivation cohort, significantly outperforming traditional clinical scores. These findings suggest TREM-1-associated NETosis as a potential contributor to the pathobiology of IVIG resistance. As a TRIPOD Type 1b derivation study, external clinical validation in independent multi-center cohorts is required prior to clinical implementation.

Phenotypic Heterogeneity in CD40 Ligand Deficiency: Long-term Follow-up of a Patient with the c.156G > A Splice Variant.

Alroqi F, AlJaber AN, Althubaiti N … +8 more , Al Tuwaijri A, Alzaaqi S, Barhoumi T, Almutairi A, Almuzzaini B, Alsayegh L, Nogoud M, Aljedaie M

J Clin Immunol · 2026 Apr · PMID 42009946 · Full text

BACKGROUND: CD40 ligand (CD40L) deficiency causes X-linked Hyper-Immunoglobulin M syndrome (XHIGM) with variable clinical severity. The splice variant c.156G > A (p.Lys52Lys) in CD40LG gene has been previously reported i... BACKGROUND: CD40 ligand (CD40L) deficiency causes X-linked Hyper-Immunoglobulin M syndrome (XHIGM) with variable clinical severity. The splice variant c.156G > A (p.Lys52Lys) in CD40LG gene has been previously reported in patients with severe opportunistic infections, including Pneumocystis jirovecii pneumonia and cryptococcal meningoencephalitis. Exploring the phenotypic variability in patients with identical genotype is critical for prognosis and genetic counseling. METHODS: We described comprehensive immunological characterization and long-term follow-up of a patient with the c.156G > A variant in CD40LG gene. Quantitative real-time (qRT-PCR) and flow cytometry were used to evaluate the CD40L protein expression. We performed in-depth analysis of lymphocyte subsets and functional assays that include T-cell proliferation and intracellular cytokine staining for IFN-γ and TNF-α. RESULTS: A hemizygous c.156G > A (p.Lys52Lys) variant at the last nucleotide of exon 1 of CD40LG gene was identified. In silico tools predicted splice donor site disruption. qRT-PCR and flow cytometry revealed marked reduction in CD40L expression. Over 23 years of follow-up with immunoglobulin replacement therapy, the patient experienced only mild recurrent sinusitis with no opportunistic infections or hospitalizations. This favorable outcome stands in contrast to a previously reported patient carrying the identical variant who developed P. jirovecii pneumonia at 3 months and cryptococcal meningoencephalitis at 26 years. CONCLUSION: This case demonstrates significant phenotypic heterogeneity in CD40L deficiency, with markedly different clinical outcomes in patients harboring identical CD40LG splice variants. Favorable long-term outcomes are achievable with early diagnosis and optimal management, even with severe genetic defects. Prognosis in CD40L deficiency should be individualized and cannot rely on genotype alone. Further research to identify genetic, immunological, and environmental modifiers of disease severity will enable personalized risk stratification and targeted therapeutic approaches.

Distinct Proteomic and Transcriptomic Profiles in T-cells and Monocytes in Patients with Common Variable Immunodeficiency: an Exploratory Study.

Yang M, Kaarbø M, Myhre V … +10 more , Fevang B, Sousa MML, Michelsen AE, Fraz MSA, Sharma A, Mollnes TE, Ueland T, Aukrust P, Bjørås M, Jørgensen SF

J Clin Immunol · 2026 Apr · PMID 41991796 · Publisher ↗

Abstract loading — click title to view on PubMed.

Immunological Manifestations in GALE Deficiency: Extending the Spectrum Beyond Thrombocytopenia and Galactosemia.

Kristal E, Khalaila A, Asleh M … +8 more , Quider AA, Eshel YD, Mahdi NE, Hadad N, Almashanu S, Miskin H, Staretz-Chacham O, Ben-Harosh M

J Clin Immunol · 2026 Apr · PMID 41986803 · Full text

BACKGROUND: Mutations in the UDP-galactose 4’-epimerase (GALE) gene disrupt the Leloir pathway of galactose metabolism and play a key role in protein and lipid glycosylation by providing essential nucleotide sugar donors... BACKGROUND: Mutations in the UDP-galactose 4’-epimerase (GALE) gene disrupt the Leloir pathway of galactose metabolism and play a key role in protein and lipid glycosylation by providing essential nucleotide sugar donors. While GALE deficiency is known to cause galactosemia and thrombocytopenia, its impact on the human immune system remains largely unexplored. We aimed to characterize a novel immunodeficiency phenotype associated with the homozygous p.R51W GALE variant. METHODS: We performed a comprehensive immunological evaluation of seven pediatric patients (aged 2.5–10 years) homozygous for the p.R51W GALE variant. Assessments included immunoglobulin levels, vaccine-specific antibody responses, lymphocyte subsets, and kappa-deleting recombination excision circles (KRECs). RESULTS: All patients exhibited profound B-cell lymphopenia (0.06–0.12 × 10^3/µl). While KREC levels were detectable, absolute counts (6–50 copies/µL) were significantly below the age-specific 5th percentile, suggesting a quantitative defect in central B-cell output. Detailed B-cell phenotyping demonstrated preservation of the full spectrum of maturation stages, indicating no absolute block in differentiation. Serum IgA and IgM were consistently low, whereas IgG levels were preserved or elevated, driven by a paradoxical increase in the IgG3 subclass. Specific antibody responses were impaired. Clinically, patients suffered from recurrent viral respiratory infections but lacked invasive bacterial disease. CONCLUSION: The p.R51W GALE variant results in a distinct hematopoietic stress phenotype characterized by significant quantitative B-cell deficiency. The absence of a clear differentiation block suggests that lymphopenia results from reduced central B-cell output combined with impaired peripheral homeostasis. We propose that the underlying GALE-mediated glycosylation defect compromises B-cell homeostasis. These findings identify GALE deficiency as a novel cause of primary immunodeficiency and suggest that immunological screening is warranted in affected patients.

Low IgM Levels in Adult IEI: Classification Challenges and Clinical Implications.

Gumusburun R, Okan K, Akdaglı E … +22 more , Yıldırım O, Akten HS, Inan S, Demiroglu G, Galata Z, Kural RF, Aytac H, Ozeki Y, Aslan E, Ates U, Kırdok K, Senturk MIT, Unal NG, Demir D, Soyer N, Soylu M, Uysal FE, Aykut A, Durmaz A, Dalgıc CT, Sin AZ, Ardeniz O

J Clin Immunol · 2026 Apr · PMID 41979700 · Full text

PURPOSE: Reduced serum IgM is increasingly encountered in adults evaluated for inborn errors of immunity (IEI), yet its clinical relevance and diagnostic utility remain uncertain. While some patients meet criteria for se... PURPOSE: Reduced serum IgM is increasingly encountered in adults evaluated for inborn errors of immunity (IEI), yet its clinical relevance and diagnostic utility remain uncertain. While some patients meet criteria for selective IgM deficiency (SIgMD), others remain unclassified, reflecting significant diagnostic heterogeneity. This study aimed to characterize adult IEI patients with low serum IgM and to assess the prognostic value of IgM levels for clinical outcomes. METHODS: Among 378 adult IEI patients followed at a tertiary immunology center, 43 individuals (11.4%) with low serum IgM were included. Clinical, immunological, genetic, and treatment data were analyzed, and associations between IgM levels and clinical outcomes were assessed using regression and ROC analyses. RESULTS: The median age was 58 years, and most patients were referred following incidental detection of hypogammaglobulinemia. Recurrent infections and allergic diseases were the most common manifestations and generally preceded IEI diagnosis. While most clinical features occurred before diagnosis, hepatobiliary disease, lymphoproliferation, osteoporosis, and malignancies showed variable timing. Median IgM memory B-cell and naïve CD8⁺ T-cell percentages were below the reference range, with reductions observed in 52.9% and 53.8% of patients, respectively, and elevated IgE levels in 35.7%. Pathogenic or likely pathogenic variants were identified in a subset of patients, often without clear genotype–phenotype correlation. Serum IgM levels demonstrated limited predictive value for clinical outcomes. CONCLUSION: Low serum IgM in adults reflects a heterogeneous immunodysregulatory state rather than a uniform immunodeficiency. Serum IgM levels alone provide limited discriminatory and prognostic value, underscoring the need for integrated clinical and immunological assessment in diagnosis and management.

Characteristics of Mycobacterial, COVID-19, and Talaromyces Marneffei Infections in Patients with IL12RB1 and IFNGR1 Mutations in Western China.

Zhang W, Zhang Z, Liu C … +11 more , Yang X, Tang W, Xing S, Chen R, Tang X, Zhang Z, Ding Y, Zhou L, Jia Y, An Y, Zhao X

J Clin Immunol · 2026 Apr · PMID 41957131 · Full text

BACKGROUND: Mendelian susceptibility to mycobacterial disease (MSMD) is a rare immunodeficiency characterized by increased vulnerability to weakly virulent mycobacteria. However, its clinical and molecular spectrum, as w... BACKGROUND: Mendelian susceptibility to mycobacterial disease (MSMD) is a rare immunodeficiency characterized by increased vulnerability to weakly virulent mycobacteria. However, its clinical and molecular spectrum, as well as its susceptibility to infections beyond mycobacteria, remains incompletely understood. OBJECTIVE: To evaluate the clinical and genetic characteristics of MSMD patients, focusing on their susceptibility to mycobacteria, SARS-CoV-2 and endemic fungal infections. METHODS: Thirteen MSMD patients underwent genetic analyses, immunological assays, and clinical evaluations. COVID-19 outcomes were documented. Pathological findings and mNGS confirmed Talaromyces marneffei infections. RESULTS: Following BCG vaccination, 92.3% (12/13) developed regional or disseminated infections. Additional infections included severe tuberculosis and Mycobacterium avium. All patients experienced SARS-CoV-2 infections and present mild symptoms. One IL12RB1-deficient patient presented with isolated disseminated Talaromyces marneffei infection but otherwise healthy. Another AR IFNGR1-deficient patient with concurrent mycobacterial and fungal infections. Genetic analysis identified five novel mutations (c.155G > C, p.C52S, c. 617 A > C, p.Q206P, c.923 A > G; p.Y308C, c.1282_1301deIACCTTGTGGTCTACGGTCCTinsC; p.T428fs* in IL12RB1 and c.811 A > T, p.K271X in IFNGR1). Functional assays confirmed impaired IL12-IFNγ axis signaling. Patients with partial IFNGR1 defects showed complete clinical remission with higher doses IFN-γ therapy basing on STAT1 phosphorylation dynamics analysis under IFN-γ activation in vitro. CONCLUSION: The patient experienced significant diagnostic delays. Adverse reactions to BCG vaccination, NTM infection or severe mycobacteria tuberculosis infections in other wise healthy children strongly suggest MSMD. MSMD patients are susceptible to SARS-CoV-2 but do not exhibit severe COVID-19. Talaromyces marneffei could be an initial manifestation of MSMD in endemic regions. Early diagnosis and targeted therapy, including IFNγ and anti-tuberculosis treatments, are critical to improving outcomes.

First Case of TAP1 Deficiency with EBV B-Cell Lymphoma Treated with Cellular Immunotherapy.

Bermejo-Olivera FJ, Velasco-Sidro M, Íñiguez-García R … +10 more , Arroyo-Sánchez D, Pleguezuelo-Garrote DE, Serrano-Blanco M, Fernández-Galván A, Baumann T, López-Jiménez FJ, Revilla-Sánchez E, Paz-Artal E, Allende LM, Cabrera-Marante O

J Clin Immunol · 2026 Apr · PMID 41954665 · Full text

PURPOSE: Mutations in TAP1 represent one cause of Bare Lymphocyte Syndrome (BLS) type I, characterized by impaired human leukocyte antigen (HLA) class I expression and increased susceptibility to infections. EBV-driven l... PURPOSE: Mutations in TAP1 represent one cause of Bare Lymphocyte Syndrome (BLS) type I, characterized by impaired human leukocyte antigen (HLA) class I expression and increased susceptibility to infections. EBV-driven lymphomas are rarely reported in BLS patients. Here, we describe the clinical management of a patient with TAP1 deficiency and discuss the treatment of an Epstein-Barr virus (EBV)-associated B cell lymphoma using cellular therapy. METHODS: We report the first case of a TAP1-deficient patient who developed EBV-associated diffuse large B-cell lymphoma (DLBCL). Clinical, immunological, histopathological and genetic evaluations were conducted. Treatment included standard chemotherapy regimens and adoptive immunotherapy with EBV-specific allogeneic T-cells (Tabelecleucel). RESULTS: A male patient presented with childhood-onset chronic respiratory infections and treatment-refractory cutaneous granulomas. Genetic testing revealed a homozygous pathogenic nonsense mutation in TAP1. The patient developed EBV+ DLBCL, refractory to rituximab-based therapies. Partial clinical stabilization was achieved with Tabelecleucel, but disease progression ensued. CONCLUSIONS: This is the first reported TAP1-deficient case developing EBV+ lymphoma, highlighting the malignancy risk in BLS. Adoptive T-cell therapy showed transient benefit, suggesting a promising, though limited, approach in refractory EBV-associated malignancies in immunodeficient patients.

A Unique NCF2 Mutation in Chronic Granulomatous Disease: Clinical and Computational Insights into NADPH Oxidase Dysfunction.

Yu H, Hu R, He J … +2 more , Tian X, Zhang T

J Clin Immunol · 2026 Apr · PMID 41941091 · Full text

Abstract loading — click title to view on PubMed.

Anifrolumab to Treat Severe Hepatic Involvement in a De Novo IFIH1 Mutation.

Romano M, Demirkaya E, Zizzo AN … +2 more , Berard RA, CAN BE AID Study Group

J Clin Immunol · 2026 Apr · PMID 41941034 · Full text

Abstract loading — click title to view on PubMed.

Expanding the Spectrum of Src-Family Kinase-Related Autoinflammatory Diseases: Monogenic Vasculitis Caused By Germline Pathogenic Variants in HCK and FGR.

Price-Kuehne F, Burleigh A, Hong Y … +13 more , Omoyinmi E, Petrof G, Malik G, McLellan K, Owens S, Lum SH, Dawson P, Turtsevich I, Robertson J, Stolagiewicz N, Roberts G, Eleftheriou D, Brogan P

J Clin Immunol · 2026 Apr · PMID 41920357 · Full text

The sarcoma (Src) family of non-receptor tyrosine kinases (SFKs) regulate innate immunity through their roles in signal transduction and cell migration, adhesion and proliferation. Germline pathogenic variants in this ke... The sarcoma (Src) family of non-receptor tyrosine kinases (SFKs) regulate innate immunity through their roles in signal transduction and cell migration, adhesion and proliferation. Germline pathogenic variants in this key kinase group are rare but increasingly recognised as causes of autoinflammatory disease. We identified three unrelated kindreds with SFK-associated vasculitis. In Family A, we report a child with systemic vasculitis due to a nonsense heterozygous variant in HCK (p.Y515X) who was subsequently treated with allogeneic haematopoietic stem cell transplantation (allo-HSCT), the first use of this approach in SFK-related disease. In Family B, we identified a novel HCK missense variant (p.Y522F) causing a cutaneous-limited phenotype. In Family C, we describe a large pedigree carrying a novel missense variant in FGR (p.Y523H), establishing FGR as a new cause of monogenic vasculitis. In all families, disease-onset was neonatal with vasculitic rash, variably progressing to systemic involvement including lung disease. Functional studies demonstrated reduced Hck and Fgr protein expression and enhanced p-STAT1 and p-STAT5 signalling in monocytes and lymphocytes. With striking similarities in the clinical phenotypes and underlying molecular mechanisms, these cases expand the spectrum of sarcoma (Src) family of non-receptor tyrosine kinase-associated autoinflammatory disease, and support this as a distinct group that we propose is termed the “autoinflammatory Src-opathies (sarcopathies)”.

Unclassified Inborn Errors of Immunity Patients without any Pathogenic Variant in Targeted Next-Generation Sequencing: Long-Term Follow-up and Whole Exome Sequencing Results.

Bas I, Topyildiz E, Ulgen E … +7 more , Sahin P, Tokgoz Erdis G, Durmaz A, Karaca NE, Aksu G, Aykut A, Kutukculer N

J Clin Immunol · 2026 Mar · PMID 41917218 · Full text

PURPOSE: In this eight-year study, children with unclassified inborn errors of immunity (IEI) who have no pathogenic variants in targeted next-generation sequencing (tNGS) were re-evaluated by using singleton whole exome... PURPOSE: In this eight-year study, children with unclassified inborn errors of immunity (IEI) who have no pathogenic variants in targeted next-generation sequencing (tNGS) were re-evaluated by using singleton whole exome sequencing (sWES) and followed-up at least five years. They were also investigated if they had affected family members or not. In addition, all patients had detailed immunological and clinical work-up. METHODS: In 2017, 108 children with probable diagnosis of IEI had tNGS and pathogenic variants were detected in 38 (35.1%) patients who were not included into the study. The rest 70 patients were continued to be immunologicaly followed-up (67.0 ± 19.7 months) and 15 of them (21.4%) recovered spontaneously. Fifty-five patients were divided into two groups; (i) familial patients (n = 30); (ii) non-familial patients (n = 25). In all of them, sWES analysis was performed. RESULTS: There were 19 affected fathers, 9 mothers and 16 siblings whereas consanguinity rate for parents was 8.5%. In sWES analysis, no genetic alterations were detected in 28 (50.9%) patients and 14 cases showed predefined pathogenic variants which are not associated with IEI. Probable IEI causing variants were found in 13 of 55 cases. However, after genotype/phenotype examinations and segregation analysis by sanger sequencing for their parents, we were able to define only three pathogenic variants in three cases, namely two for IKBKB gene and one for PRKDC in familial cases. Fifty-five cases were screened with sWES and only three pathogenic variants were revealed (3/55, 5.45%). When we add this result to tNGS finding (35.1%), all together 40.55% of unclassifed IEI cases could be defined by both of these genetic investigations. CONCLUSION: Even with NGS-based approaches improving IEI diagnoses, detection rates still remain below 50%. Whole genome sequencing in the near future would offer the advantage of much more comprehensive and accurate variant detections.

Continuous Infusion of the CXCR4 Antagonist Plerixafor for WHIM Syndrome.

McDermott DH, Majumdar S, Velez D … +9 more , Cho E, Li Z, Gao JL, Grieco MC, Lawrence MG, Silva SL, Castelo-Soccio LA, Follmann D, Murphy PM

J Clin Immunol · 2026 Mar · PMID 41904735 · Full text

BACKGROUND: WHIM (Warts, Hypogammaglobulinemia, Infections and Myelokathexis) syndrome is an ultrarare inborn error of immunity caused by heterozygous, hyperfunctional CXCR4 mutations that impede leukocyte egress from bo... BACKGROUND: WHIM (Warts, Hypogammaglobulinemia, Infections and Myelokathexis) syndrome is an ultrarare inborn error of immunity caused by heterozygous, hyperfunctional CXCR4 mutations that impede leukocyte egress from bone marrow, resulting in panleukopenia. The CXCR4 antagonist plerixafor (AMD3100, Mozobil) durably reverses panleukopenia and in most WHIM patients also induces wart regression; however, its short half-life requires twice daily injection. OBJECTIVE: The aim of this study was to assess the safety and efficacy of continuously infused plerixafor in patients with WHIM syndrome. METHODS: We conducted a Phase 1/2 pilot study of WHIM patients given plerixafor 0.02–0.08 mg/kg/d by continuous subcutaneous infusion for 1–2 years using an OmniPod insulin pump, and assessed compliance as well as effects on blood leukocyte counts, infections, chronic skin conditions and adverse events. RESULTS: Six patients were treated for a total of 6.3 patient-years; one patient dropped out early for personal reasons related to taking a new job. The drug infusion rate was adjusted to achieve a normal absolute lymphocyte count and an absolute neutrophil count > 500 cells/µl in all patients. An average of 2.1 infections/patient-year occurred (range 0–4). Treatment of two infections involved brief hospitalization. On plerixafor, partial wart regression occurred in 3 of 4 patients, a single molluscum contagiosum infection regressed and a chronic post-Mohs surgical wound epithelialized. There were 3 serious adverse events, but none was attributable to the treatment. All patients preferred pump administration over syringe injection. CONCLUSION: In WHIM patients a continuous infusion pump may be a convenient, safe and potentially effective means of delivering plerixafor chronically to correct panleukopenia and to improve chronic skin conditions.

A Novel Phosphoglucomutase-3 Gene Variant Causing Milder Phenotype in Two Families.

Gemici Karaaslan B, Benamar M, Ulas S … +12 more , Aydemir S, Yesil G, Gezdirici A, Sari AA, Nepesov S, Cokugras H, Camcioglu Y, Ayaz A, Aydogmus C, Charbonnier LM, Chatila T, Kiykim A

J Clin Immunol · 2026 Mar · PMID 41904308 · Full text

BACKGROUND: Phosphoglucomutase 3 deficiency (PGM3 deficiency) is a rare congenital disorder of glycosylation classically associated with severe immunodeficiency, skeletal abnormalities, and neurodevelopmental impairment.... BACKGROUND: Phosphoglucomutase 3 deficiency (PGM3 deficiency) is a rare congenital disorder of glycosylation classically associated with severe immunodeficiency, skeletal abnormalities, and neurodevelopmental impairment. However, emerging evidence suggests that PGM3 deficiency may also present with attenuated or milder clinical phenotypes. In this study, we describe patients with a novel PGM3 variant exhibiting a less severe immunological and clinical presentation, thereby expanding the known phenotypic spectrum of PGM3 deficiency. METHODS: Demographic-data and Wechsler Intelligence Scale for Children profiles were evaluated alongside laboratory data, including complete blood cell counts, lymphocyte subsets, serum immunoglobulin levels, vaccine antibody titers, and lymphocyte cytokine profiles. Whole exome sequencing was conducted, and phospho-flow assays were utilized for the analysis of p-STATs. RESULTS: Five patients with a mild form of PGM3 deficiency were described, exhibiting a Hyper-IgE Syndrome phenotype without severe skeletal dysplasia or dysmorphism, with the exception of one patient displaying very mild skeletal dysplasia and three patients exhibiting mild to moderate intellectual disability. All patients demonstrated an increase in Natural Killer T cells and a decrease in B cells, alongside an increase in activated CD4 + T cells (CD45RO+), a decrease in naïve CD4 + and CD8 + T cells (CD45RA+ CCR7+), and an increase in TEMRA CD8 + T cells (CD45RA+CCR7–). Functional analysis of all patients revealed impaired PGM3 function, as evidenced by decreased surface expression of gp130 and p-STAT3. CONCLUSION: Defective glycosylation in PGM3 deficiency leads to reduced gp130 expression and attenuated gp130-dependent STAT3 phosphorylation. The resulting cellular features partially overlap with those observed in STAT3 loss-of-function and gp130 deficiency, supporting a shared signaling mechanism while remaining clinically distinct.

Allogeneic Hematopoietic Cell Transplantation for Congenital Athymia: A Nationwide Retrospective Study in Japan.

Nishinosono T, Muramatsu H, Wakamatsu M … +8 more , Sonoda M, Eguchi K, Kawaguchi K, Yamamoto T, Kudo T, Kajiwara M, Ishimura M, Takahashi Y

J Clin Immunol · 2026 Mar · PMID 41902846 · Full text

PURPOSE: Congenital athymia is a life-threatening condition characterized by thymic absence and profound T-cell immunodeficiency. Thymus implantation is the definitive treatment, but its availability is limited. This stu... PURPOSE: Congenital athymia is a life-threatening condition characterized by thymic absence and profound T-cell immunodeficiency. Thymus implantation is the definitive treatment, but its availability is limited. This study aimed to evaluate the outcomes of hematopoietic cell transplantation (HCT) as an alternative therapy. METHODS: A nationwide, multicenter, retrospective study analyzed nine patients who underwent allogeneic HCT between 2000 and 2024 in Japan. Overall survival (OS) was estimated using the Kaplan-Meier method, and the cumulative incidence of immunodeficiency-related mortality was assessed using Gray's test. RESULTS: Among the nine patients, eight (89%) received umbilical cord blood, and one (11%) received related peripheral blood. Seven patients (78%) underwent transplantation without conditioning. Engraftment with T-cell recovery was achieved in six patients (67%), with a median CD4 T-cell count of 0.352 × 10/L (range, 0.216-1.578 × 10/L) at the last follow-up. Acute graft-versus-host disease (GVHD) occurred in five patients (56%), all with Grade I-II skin involvement. No chronic GVHD was observed. The one-year OS rate was 66.7% (95% confidence interval: 28.2%-87.8%). Overall, six patients (67%) died: three early deaths within the first month from infections, and three late deaths beyond 1 year from congenital comorbidities. HCT before six months of age was associated with significantly lower immunodeficiency-related mortality (p = 0.02). CONCLUSION: HCT can allow immune reconstitution in congenital athymia, although long-term survival is affected by comorbidities. Early diagnosis and timely intervention are crucial in managing this condition. HCT can be a restricted alternative therapy for patients ineligible for thymus implantation.

Optical Genome Mapping for the Identification of Complex Structural Variants in Hereditary Angioedema.

Batlle-Masó L, Neveling K, Gil-Serrano J … +11 more , Kamping E, den Ouden A, Timmermans R, Bruch-Tàrrega A, Aguiló-Cucurull A, Perurena-Prieto J, Fernández-Álvarez P, Steehouwer M, Hoischen A, Guilarte M, Colobran R

J Clin Immunol · 2026 Mar · PMID 41896320 · Full text

PURPOSE: Hereditary angioedema due to C1-inhibitor deficiency (HAE-C1INH) is caused by heterozygous pathogenic variants in the SERPING1 gene. Structural variants (SVs) account for 10–15% of cases, and while many can be i... PURPOSE: Hereditary angioedema due to C1-inhibitor deficiency (HAE-C1INH) is caused by heterozygous pathogenic variants in the SERPING1 gene. Structural variants (SVs) account for 10–15% of cases, and while many can be identified using conventional diagnostic approaches such as multiplex ligation-dependent probe amplification (MLPA), some remain difficult to detect. This study aims to assess the utility of optical genome mapping (OGM) for the detection of both typically described and atypical structural variants in HAE-C1INH. METHODS: MLPA, OGM, long-read whole-genome sequencing (LR-WGS), Sanger sequencing and cDNA analysis. RESULTS: First, we assessed whether OGM could detect common SVs in HAE-C1INH affecting the SERPING1 coding region. We tested a family previously diagnosed by MLPA with a large heterozygous deletion encompassing exons 1–2 of SERPING1. OGM successfully identified this deletion in both affected members. Next, we analyzed a three-generation HAE-C1INH family with no genetic findings after Sanger sequencing and MLPA. OGM revealed a 3.8 kb insertion in SERPING1, which was further characterized using LR-WGS as a SINE-VNTR-Alu (SVA) mobile element inserted in intron 7, demonstrating the complementary role of LR-WGS in precisely defining the nature and location of SVs detected by OGM. Finally, we demonstrated that the allele carrying the SVA insertion was absent in cDNA resulting in SERPING1 functional haploinsufficiency in this family. CONCLUSION: OGM is a reliable and robust technique for detecting SVs affecting both coding and non-coding regions in HAE-C1INH. Using OGM, we report the first case of HAE-C1INH caused by the insertion of an SVA mobile element.
← Prev Page 2 of 10 Next →

About

Frequency
Sun
Papers found
200
RSS feed
Subscribe