Iranian Journal Of Allergy, Asthma, And Immunology[JOURNAL]
Sun
200 papers
Luteolin Ameliorates Allergic Rhinitis in Mice through Modulating T Cell Subset Imbalance, Endoplasmic Reticulum Stress, and NLRP3 Inflammasome Axes.
Guo X, Liu Y, Chen X
Iran J Allergy Asthma Immunol · 2025 May · PMID 40471643 · Publisher ↗
Luteolin (LO) possesses pharmacological benefits like anti-inflammatory, antioxidant, and immune-boosting properties. This study aims to clarify the effect of LO on allergic rhinitis (AR) and its mechanisms and provide n...
Luteolin (LO) possesses pharmacological benefits like anti-inflammatory, antioxidant, and immune-boosting properties. This study aims to clarify the effect of LO on allergic rhinitis (AR) and its mechanisms and provide new insights for the clinical application of LO. A mouse model for AR was developed through ovalbumin (OVA) stimulation. AR mice were gavaged with saline, low, medium, and high concentrations of LO, and montelukast. Nasal symptoms and scores were evaluated. The levels of OVA-specific immunoglobulins (OVA-sIgs), T helper cells (Th1, Th2, Th17), regulatory T cells (Tregs) cytokines, along with proinflammatory cytokines were measured using enzyme-linked immunosorbent assay (ELISA). Histopathological alterations were observed utilizing hematoxylin-eosin staining. Interleukin (IL)-1β and IL-18 levels were assessed through immunohistochemistry. Flow cytometry measured the percentage of T lymphocytes. The levels of endoplasmic reticulum stress (ERS)-related and NOD-like receptor family pyrin domain containing 3 (NLRP3) inflammasome-related mRNAs and proteins were analyzed through reverse transcription-polymerase chain reaction (RT-PCR) and Western blot. LO reduced nasal symptom scores in AR mice, upregulated OVE-sIgG2a levels, and downregulated OVE-sIgE, OVE-sIgG1, and histamine levels. After the administration of LO, AR mice showed an increase in Th1 and Treg cytokines levels, while Th2 and Th17 cytokines levels were reduced. LO ameliorated the splenic T cell subset imbalance and attenuated inflammatory cell infiltration. LO reduced the levels of ERS-related and NLRP3 inflammasome activation-related mRNAs and proteins in the nasal mucosa. LO ameliorated AR symptoms by regulating T cell subset imbalance, hindering ERS and NLRP3 inflammasome activation.
Role of USP10/METTL3/CXCR4 Axis in Immunotherapy of Castration-Resistant Prostate Cancer.
Chen W, Xu L, Deng H … +2 more , Zhu Z, Yang D
Iran J Allergy Asthma Immunol · 2025 May · PMID 40471642 · Publisher ↗
The aim of this study was to investigate the role of the ubiquitin specific peptidase 10 (USP10/methyltransferase like 3 (METTL3)/C-X-C chemokine receptor type 4 (CXCR4) axis in immunotherapy of castration-resistant pros...
The aim of this study was to investigate the role of the ubiquitin specific peptidase 10 (USP10/methyltransferase like 3 (METTL3)/C-X-C chemokine receptor type 4 (CXCR4) axis in immunotherapy of castration-resistant prostate cancer (CRPC). Knockdown experiments were conducted in CRPC cell lines to assess the effect of targeting CXCR4 on cell proliferation invasion and migration. Coculture experiments of CXCR4 knockdown CRPC cells with THP1-M0 were performed to evaluate their impact on macrophage polarization and migration ability. With CD8+ T cells was conducted to assess their effects on CD8+ T cell proliferation and apoptosis. CXCR4-overexpressing CRPC cells were treated with the JAK-2 specific inhibitor AG490 to assess the effect of CXCR4 through the JAK2/STAT3 pathway on CRPC. The mechanisms by which USP10 regulates CXCR4 expression through targeting METTL3 were explored through dataset analysis, bioinformatics prediction, and Western blot. In CRPC tissues and cells, there was an observed increase in CXCR4 expression. Suppressing CXCR4 through knockdown methods resulted in the inhibition of CRPC cell growth, movement, and infiltration. Additionally, it led to a reduction in M2 polarization and the recruitment of Tohoku Hospital Pediatrics-1 (THP1) M0 macrophages, along with a mitigation of CD8+ T cell exhaustion. Dataset analysis, bioinformatics prediction, and Western blot validation indicated that CXCR4 activates the JAK2/STAT3 pathway to promote the expression of CCL2 and PD-L1, while USP10 promotes CXCR4 expression through METTL3. Our study underscores the significance of the USP10/METTL3/CXCR4 axis in immunotherapy for CRPC and CXCR4 as a potential target for therapeutic intervention in CRPC treatment.
A Novel Nanodrug Suppresses Lung Cancer Growth and Metastasis in C57BL/6 Mouse Model by Altering CD8+ Cell Infiltration and Oxidative Stress.
Shekarchian S, Eghtedardoost M, Golshahi H … +3 more , Behrouzfar H, Fakhroueian Z, Yaraee R
Iran J Allergy Asthma Immunol · 2025 May · PMID 40471641 · Publisher ↗
Lung cancer is a leading cause of cancer deaths worldwide and new therapeutic approaches are needed. This study investigates the efficacy of a new zinc oxide-based nanomedicine in a mouse model of heterotopic lung cancer...
Lung cancer is a leading cause of cancer deaths worldwide and new therapeutic approaches are needed. This study investigates the efficacy of a new zinc oxide-based nanomedicine in a mouse model of heterotopic lung cancer. C57BL/6 mouse model with Lewis lung carcinoma (LL2) cells was used. The mice were treated with different doses of nanodrug, cisplatin, or phosphate-buffered saline. Tumor growth, metastasis, markers for oxidative stress, and immune responses, in particular the infiltration of CD8+ T cells, were examined. The nanodrug significantly reduced tumor size, inhibited metastasis, and improved survival compared to the control group. Moreover, no significant toxic effect was observed in hematological, biochemical and histopathological analyses. Furthermore, the nanodrug altered the tumor microenvironment in favor of immune system activation by modulating the level of oxidative stress and increasing CD8+ cell infiltration. The results show that this new nanomedicine may be a candidate for an effective treatment for lung cancer.
Evaluation of T-cell Function after Blood Transfusion in Patients Undergoing Coronary Artery Bypass Grafting.
Golafshani N, Golafshani N, Mohseni AR … +6 more , Mohseni M, Najafi A, Ziabakhsh-Tabari S, Asgarian-Omran H, Tehrani M, Pourfathollah A
Iran J Allergy Asthma Immunol · 2025 May · PMID 40471640 · Publisher ↗
Blood transfusion is associated with increased mortality and morbidity. This study aimed to determine the effect of blood transfusion on T-helper 1 (TH1), TH2, and TH17 function in patients undergoing coronary artery byp...
Blood transfusion is associated with increased mortality and morbidity. This study aimed to determine the effect of blood transfusion on T-helper 1 (TH1), TH2, and TH17 function in patients undergoing coronary artery bypass grafting (CABG). Two blood samples were obtained from patients undergoing CABG, before and 14 days after surgery. Production of interleukin (IL)-2, IL-4, interferon (IFN)-γ, IL-17A, and IL-10 by CD4+ T cells was measured using enzyme-linked immunosorbent assay (ELISA). mRNA expression of T-box expressed in T cells (T-bet), GATA binding protein 3 (GATA3), RAR-related orphan receptor-γ (ROR-γt), signal transducer and activator of transcription 3 (STAT3), STAT4, and STAT6 were measured using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR). mRNA expression of T-bet and STAT4 showed a significant decrease after blood transfusion. However, the concentration of IFN-γ in the culture supernatant showed no significant difference after blood transfusion. mRNA expression of GATA3 and STAT6 showed a significant decrease after blood transfusion. However, the concentration of IL-4 in the culture supernatant showed no significant difference after blood transfusion. mRNA expression of ROR-γt showed no significant decrease after blood transfusion; however, the expression of STAT3 and the concentration of IL-4 in the culture supernatant did significantly decrease following blood transfusion. IL-10 production increased significantly postoperatively. Decreased TH1, TH2, and TH17 signaling pathway activity and increased IL-10 concentration indicate an immunomodulatory effect on the immune system after blood transfusion.
The Effect of Probiotic Yogurt Containing Lactobacillus rhamnosus and Bifidobacterium bifidum on Disease Activity and Disability in Patients with Systemic Lupus Erythematosus: A Randomized Controlled Trial.
Banaki R, Faezi ST, Esmaeilzadeh A … +3 more , Mahmoudi M, Farhadi E, Alikhani M
Iran J Allergy Asthma Immunol · 2025 May · PMID 40471639 · Publisher ↗
Systemic lupus erythematosus (SLE) is an autoimmune rheumatic disease with relapsing and remitting periods. Systemic lupus erythematosus (SLE) is an autoimmune rheumatic disease with relapsing and remitting periods. It h...
Systemic lupus erythematosus (SLE) is an autoimmune rheumatic disease with relapsing and remitting periods. Systemic lupus erythematosus (SLE) is an autoimmune rheumatic disease with relapsing and remitting periods. It has been reported that alterations of gut microbiota can affect disease activity in SLE. Probiotics which can modify the gut microbiota may be useful to control disease activity. Therefore, the effect of probiotic yogurt was evaluated on SLE disease activity. In this triple-blind, randomized, controlled trial, the patients were randomized and divided into 2 groups. The patients had Systemic Lupus Erythematosus Disease Activity Index (SLEDAI) ≤6 and were on a stable dose of immunosuppressant in the last 3 months. The intervention group was given 200 g of probiotic yogurt containing Lactobacillus rhamnosus and Bifidobacterium bifidum for 13 weeks. The control group was given 200 g of yogurt without bacteria for 13 weeks. Demographic measurements, SLEDAI, and Health Assessment Questionnaire (HAQ) were analyzed before and after the intervention. The probiotic group (19 patients) and the control group (14 individuals) were compared. At the beginning and baseline of the trial, the probiotic and control groups' average energy intake, micronutrients, and macronutrients did not differ significantly. In the probiotic group, the amount of protein, cholesterol, magnesium, zinc, selenium, and iron intake increased significantly after intervention. There are no significant changes in SLEDAI score and disability (HAQ) between case and control groups at the end of the study. Consumption of probiotic yogurt containing L rhamnosus and B bifidum did not have a significant short-term effect on SLEDAI and disability in SLE patients.
Chronic Spontaneous Urticaria: A Closer Look at Antinuclear Antibodies and Their Autoimmune Implications.
Shahabi H, Mahlooji Rad M, Soheili H … +1 more , Ghazanfari T
Iran J Allergy Asthma Immunol · 2025 May · PMID 40471638 · Publisher ↗
Autoimmune activities in chronic spontaneous urticaria (CSU) are claimed to be one of the most common causes of disease pathogenesis. This study aims to evaluate the prevalence and patterns of antinuclear antibodies (ANA...
Autoimmune activities in chronic spontaneous urticaria (CSU) are claimed to be one of the most common causes of disease pathogenesis. This study aims to evaluate the prevalence and patterns of antinuclear antibodies (ANA) in patients with CSU, investigate the relationship between ANA positivity and autologous serum skin test (ASST) results, and explore the implications of these findings for understanding the potential autoimmune nature of CSU, particularly in relation to immunoglobulin E (IgE) levels. We analyzed data from 60 patients with CSU at Jahad Daneshgahi Clinic, Tehran, Iran. Patients were categorized based on ASST results (30 positive and 30 negative). Laboratory evaluations included ANAs via indirect immunofluorescence using the HEp-20-10 biochip kit. Data analysis was performed using chi-square and Mann-Whitney U tests. Among the 60 CSU patients, 37 were ANA-positive, with common patterns being nuclear fine-speckled and nucleolar. A decrease in IgE levels among ANA-positive patients compared to ANA-negative ones was also observed. Our study uncovered a notable 61.6% prevalence of ANA positivity among CSU patients, exceeding previously reported rates. The identification of nuclear fine-speckled and punctate nucleolar patterns may indicate associations with specific autoimmune conditions that warrant further investigation. Additionally, the observed lower IgE levels in ANA-positive patients suggest a distinct immunological profile, potentially reflecting type IIb autoimmunity.
A comparison of Spirometry Versus Impulse Oscillometry in Patients with Asthma Based on Asthma Severity.
Heydarazad Zadeh M, Mahdaviani SA, Eslaminejad A … +1 more , Rekabi M
Iran J Allergy Asthma Immunol · 2025 May · PMID 40471637 · Publisher ↗
Measuring the performance of small airways dysfunction is challenging due to their relative inaccessibility with conventional methods. In recent years, spirometry and impulse oscillometry (IOS) methods have been widely u...
Measuring the performance of small airways dysfunction is challenging due to their relative inaccessibility with conventional methods. In recent years, spirometry and impulse oscillometry (IOS) methods have been widely used for their evaluation. The aim of this study was to investigate the relationship between spirometric parameters and IOS in newly diagnosed asthma (NDA) patients. In this cross-sectional study, 100 NDA patients who referred to the allergy Clinic of Masih Daneshvari Hospital between 2021 and 2023 were enrolled. IOS and spirometry tests were performed for all patients. Spirometry measures included forced vital capacity (FVC), forced expiratory volume in the first second (FEV1), FEV1/FVC, and forced expiratory flow (FEF25-75). IOS criteria included R5%, R20%, R5-R20%, X5%, Ax% and FRES. The relationship between spirometry and IOS parameters was evaluated. The mean age was 22.6±9.5 years. None of the 2 techniques had a significant relationship with disease severity. FVC, FEV1/FVC and FEF25-75 indices had a significant positive correlation with all other IOS indices except for Ax. In the comparison of FEF25-75 parameter in spirometry, 4 IOS indices including R5, R20, R5-R20 and X5 had appropriate sensitivity and specificity for predicting asthma. In the comparison of FEF25-75 parameter in spirometry, 4 IOS indices including R5, R20, R5-R20 and X5 had appropriate sensitivity and specificity for predicting asthma. The sensitivity and specificity of R5 for asthma diagnosis were 0.85 and 0.73, respectively. Further multicenter studies with larger sample sizes are recommended to confirm these results.
Effect of Montelukast and Budesonide Aerosol Inhalation in the Treatment of Allergic Rhinitis and asthma in Children and Its Effect on the Inflammatory Response of Children.
Li H, Nie L, Zhang T … +2 more , Chen Z, Gao S
Iran J Allergy Asthma Immunol · 2025 May · PMID 40471636 · Publisher ↗
Studies have investigated montelukast and budesonide aerosol inhalation for treating allergic rhinitis (AR) and bronchial asthma (BA) in children. However, there are significant variations in dosage and duration of admin...
Studies have investigated montelukast and budesonide aerosol inhalation for treating allergic rhinitis (AR) and bronchial asthma (BA) in children. However, there are significant variations in dosage and duration of administration. This research evaluated the efficacy in children with AR and BA and analyzed montelukast's impact on the inflammatory response. This retrospective cohort study involved 100 children with AR and BA who were admitted to "Baoding Hospital, Beijing Children's Hospital Affiliated with the Capital Medical University" from October 2022 to September 2023. They were divided into a budesonide group (budesonide n=50) and a combination group (montelukast and budesonide, n=50). Comparisons were made between the two groups in terms of clinical efficacy, severity scores of AR and BA before and after treatment, inflammatory indicators (interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α)), pulmonary function indicators (forced expiratory volume in the first second (FEV1), peak expiratory flow rate (PEF)), and adverse reactions. After treatment, the severity scores of AR and BA in the combination group were 4.00±0.93 points and 2.64±0.56 points, which were lower than those in the budesonide group (5.14±0.66 points and 3.31±0.65 points, respectively). The total response rate of the combination group (96.00%) was higher than that of the budesonide group (80.00%). The levels of IL-6 and TNF-α in the combination group were lower than those in the budesonide group, and the levels of FEV1 and PEF in the combination group were higher than those in the budesonide group. Mometasone combined with budesonide shows good treatment effects in children with AR and BA.
Immunotherapeutic Potential of Echinococcus granulosus Hydatid Cyst Antigens in Autoimmune Disease and Allergy.
Samei A, Khedri M
Iran J Allergy Asthma Immunol · 2025 May · PMID 40471635 · Publisher ↗
This study explores recent advances in harnessing the immunotherapeutic potential of hydatid cyst antigens for the treatment of allergies and autoimmunity. The aim is to elucidate the immunotherapeutic mechanisms employe...
This study explores recent advances in harnessing the immunotherapeutic potential of hydatid cyst antigens for the treatment of allergies and autoimmunity. The aim is to elucidate the immunotherapeutic mechanisms employed by these parasite antigens. The hydatid cyst is considered the larval stage of Echinococcus granulosus, a parasitic helminth with life cycles involving a carnivorous definitive host (usually dogs) and an intermediate herbivore host (human, ungulate, or rodent). The two major species of this parasite with human public health importance are E granulosus and E multilocularis. E granulosus is a highly immunogenic organism that stimulates proinflammatory responses, significant antibody production, and T cell-mediated responses. Host adaptive immune responses to the parasite are TH2 dominant, but responses are absent in one-fifth of patients. Diagnostic antigens from cyst fluid are well-known, and the high abundance of hydatid cysts in the lungs and livers of slaughtered farm animals has made it easy to access the source of cyst antigens. Emerging from current preclinical studies, antigens derived from hydatid cyst cells and fluid show potential for suppressing and regulating immune responses associated with allergic and autoimmune conditions, disorders which increase with Western-type human development.
Association between IFN-γ +874T/A SNP and COVID-19 Severity.
Seyyed Rezaei SA, Asgharzadeh V, Mahdavi Poor B … +7 more , Asgharzadeh M, Poorghani A, Asghari Ozma M, Khalili AA, Jalaei Nobari H, Raeisi M, Rashedi J
Iran J Allergy Asthma Immunol · 2025 Mar · PMID 40211503 · Publisher ↗
The severity of coronavirus disease 2019 (COVID-19) varies significantly among individuals, which indicates the impact of individual differences on disease. Emerging evidence suggests that genetic factors play a crucial...
The severity of coronavirus disease 2019 (COVID-19) varies significantly among individuals, which indicates the impact of individual differences on disease. Emerging evidence suggests that genetic factors play a crucial role in determining the severity of the disease. For instance, variants in the interferon-gamma (IFN-γ) gene, such as the +874 T/A single nucleotide polymorphism (SNP), have been linked to altered immune responses and may influence the severity of COVID-19. We aim to determine the influence of the IFN-γ +874T/A SNP on the clinical outcomes of COVID-19 patients. We investigated the SNP at position +874 in the promoter region of the IFN-γ gene in 416 individuals (206 critically ill COVID-19 patients and 210 healthy controls) in northwestern of Iran. Genomic DNA was extracted from the blood leukocytes of the patients, and the SNP was analyzed using the amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) method. The AA genotype was significantly more frequent in critically ill COVID-19 patients than in healthy controls. Conversely, the AT and TT genotypes were more common in healthy controls. Furthermore, the A allele was more frequent in critically ill patients than in healthy controls, while the T allele was more frequent in healthy controls compared to critically ill patients. Our study identified the IFN-γ +874T/A SNP as a significant genetic factor influencing COVID-19 severity. This finding underscores the critical role of genetic factors in disease severity and highlights the importance of personalized medicine in managing COVID-19.
Prognostic and Immunotherapeutic Value of Regulatory T Cell Marker Gene Signature in Melanoma.
Liu Y, Liu J, Jiang K … +4 more , Cheng X, Di S, Tang J, Luo B
Iran J Allergy Asthma Immunol · 2025 Mar · PMID 40211502 · Publisher ↗
Regulatory T cells (Tregs) are central to establishing an immunosuppressive tumor microenvironment (TME), which promotes cancer progression and influences therapeutic outcomes. However, the prognostic significance of Tre...
Regulatory T cells (Tregs) are central to establishing an immunosuppressive tumor microenvironment (TME), which promotes cancer progression and influences therapeutic outcomes. However, the prognostic significance of Treg-related genes (TRGs) in predicting immunotherapy response in melanoma remains insufficiently characterized. This study seeks to elucidate the role of TRGs in the antitumor immune response of melanoma. The ordinary transcriptome and single-cell RNA sequencing (scRNA-seq) data were obtained from the gene expression omnibus and the cancer genome atlas databases. A multi-tiered quality control process was applied to scRNA-seq data, followed by cell annotation, cell-cell communication, and enrichment analysis to investigate Treg function in the melanoma microenvironment. Weighted gene coexpression network analysis (WGCNA) was employed to identify modules associated with Treg infiltration. Key prognostic genes were identified using univariate Cox regression analysis and integrated into a prognostic model through least absolute shrinkage and selection operator and stepwise regression methods. The analysis revealed a Treg-related gene signature (TRGS) comprising CHD3, FOSB, SEMA4D, PSME1, FYN, PRKACB, and ARID5A. Higher TRGS-based risk scores were significantly associated with worse prognoses, immune cell infiltration, and stromal scores. TRGS was identified as an independent prognostic indicator for melanoma, offering novel insights into the role of Tregs in modulating the TME. This study highlights the potential clinical utility of TRGs in melanoma diagnostics and personalized immunotherapy, providing a robust foundation for future therapeutic strategies.
Discovery and Validation of Immune Infiltration-related Genes for the Prognosis of Osteoporosis.
Xu H, Xu F, Chen L … +3 more , Wu R, Ge H, Li A
Iran J Allergy Asthma Immunol · 2025 Mar · PMID 40211501 · Publisher ↗
Osteoporosis (OP), a widespread musculoskeletal disorder characterized by fragile bone fractures, has seen increasing attention regarding immune infiltration-related genes. These genes show significant predictive value i...
Osteoporosis (OP), a widespread musculoskeletal disorder characterized by fragile bone fractures, has seen increasing attention regarding immune infiltration-related genes. These genes show significant predictive value in solid tumor prognosis and are now being explored for their roles in musculoskeletal diseases. This study identified osteoporosis-associated differentially expressed immune genes (OP-DEGs) by analyzing the overlap between OP-differentially expressed genes and immune genes. To elucidate the functional implications of these genes, pathway enrichment analysis was conducted using Gene Ontology and KEGG databases. Additionally, Gene Set Enrichment Analysis (GSEA) and Gene Set Variation Analysis (GSVA) were employed to explore underlying mechanisms. A competitive endogenous RNA (ceRNA) network was constructed for critical OP-related immune genes, and immune infiltration analysis investigated micro-environmental characteristics. The diagnostic effectiveness of OP was evaluated using ROC curves. Finally, RT-PCR determined the expression levels of 15 key OP-related immune genes in OP and control groups. The study identified 29 OP-DEGs. Extensive bioinformatics analysis pinpointed 15 key genes that could serve as potential biomarkers for OP diagnosis. RT-PCR results revealed significantly increased expression of VEGFA, HMOX1, RARA, CXCL10, hsa-miR-129-2-3p, OIP5-AS1, and HCG18 in the OP group compared to controls. Our findings suggest that these immune-related genes may predict OP prognosis and offer new perspectives for early prevention and intervention strategies. The identification of specific immune genes involved in OP development highlights their potential as therapeutic targets for further investigation.
Oxymatrine Attenuates High Glucose-induced NLRP3 Inflammasome-dependent Pyroptosis and Injury in Podocytes by Regulating SIRT1/NF-κB Pathway.
Ouyang H, Chen D, Liu W
Iran J Allergy Asthma Immunol · 2025 Mar · PMID 40211500 · Publisher ↗
Diabetic nephropathy is a microvascular complication that leads to renal injury. Oxymatrine (OMT) is a matrine alkaloid and has been shown to ameliorate diabetic nephropathy. However, it is still unknown whether its mech...
Diabetic nephropathy is a microvascular complication that leads to renal injury. Oxymatrine (OMT) is a matrine alkaloid and has been shown to ameliorate diabetic nephropathy. However, it is still unknown whether its mechanism involves podocytes, which play a critical role in diabetic nephropathy. High glucose-induced podocytes (MPC5) were treated with OMT, the NOD-like receptor protein 3 (NLRP3) inhibitor MCC950, and the sirtuin 1 (SIRT1) inhibitor EX527. The effects on podocyte proliferation and apoptosis were assessed using cell counting kit-8 and flow cytometry. Immunofluorescence staining was performed to detect the expression of podocyte-associated proteins, NLRP3 inflammasome, and SIRT1. The levels of interleukin (IL)-1β and IL-18 were measured by enzyme-linked immunosorbent assay. Additionally, Western blot analysis was conducted to evaluate podocyte-related proteins, NLRP3 inflammasome-dependent pyroptosis-related proteins, and SIRT1/nuclear factor kappa B (NF-κB) pathway proteins, aiming to elucidate the mechanisms by which OMT improves podocyte injury. OMT significantly promoted the proliferation of podocytes exposed to high glucose, inhibited their apoptosis, increased the levels of nephrin, Wilms tumor 1, podocin, and zonula occludens-1, and reduced pyroptosis-related proteins, IL-1β, and IL-18 (p < 0.05). It also increased SIRT1 and decreased the acetylation of NF-κB p65 (p < 0.05). The NLRP3 inhibitor MCC950 reduced podocyte pyroptosis under high glucose conditions, while the SIRT1 inhibitor EX527 reversed the protective effects of OMT on NLRP3 inflammasome-dependent pyroptosis and podocyte injury. OMT ameliorates high glucose-induced podocyte injury by regulating the SIRT1/NF-κB pathway and inhibiting NLRP3 inflammasome-dependent pyroptosis.
Clinical Characterization and Mutation Analysis of 13 Iranian Ataxia Telangiectasia Patients: Introducing Two Novel Mutations.
Badalzadeh M, Soleimani Bavani M, Alizadeh Z … +16 more , Mirmoghtadaei M, Shakerian L, Bahram S, Molitor A, Carapito R, Moradi L, Razaghian A, Assari R, Movahedi M, Shariat M, Houshmand M, Habibi L, Hamidieh AA, Ashrafi MR, Fazlollahi MR, Pourpak Z
Iran J Allergy Asthma Immunol · 2025 Mar · PMID 40211499 · Publisher ↗
Ataxia Telangiectasia (A-T) is a rare autosomal recessive neurodegenerative disease caused by mutations in the ataxia telengiectasia mutated (ATM) gene. The gene is on chromosome 11q22-23 and codes for the protein kinase...
Ataxia Telangiectasia (A-T) is a rare autosomal recessive neurodegenerative disease caused by mutations in the ataxia telengiectasia mutated (ATM) gene. The gene is on chromosome 11q22-23 and codes for the protein kinase ATM, which plays an essential role in DNA damage repair. In this study, we review the clinical characteristics of 13 A-T patients, 2 of whom displayed novel mutations. Thirteen patients with ataxia-telangiectasia from 10 unrelated families were referred to Immunology, Asthma and Allergy Research Institute, Tehran, Iran. After clinical confirmation, blood samples were collected from the patients and their parents. Genetic analysis for 8 patients was conducted using whole-exome sequencing; in the other 3 patients, polymerase chain reaction was used, followed by sequencing. We identified 11 different mutations in the ATM gene. Two patients had mutations as compound heterozygous, while 9 other patients were homozygous for the mutations. Among these, 2 likely pathogenic mutations (ie, c.2639-1G>A and c.7940_7970delTTCCAGCAGACCAGCCAATTACTAAACTTAA) have not been reported. Our study highlights the significance of next-generation sequencing techniques in identifying novel ATM mutations in A-T patients. Although all reported A-T mutations reside in 1 gene, the absence of a mutation hotspot for this gene necessitates the use of next-generation sequencing techniques. Specifically, we identified 2 mutations that have not been reported previously, emphasizing the importance of continued research in this area. This study provides new insights into the genetic underpinnings of A-T and underscores the potential clinical implications of identifying novel mutations.
The Immune Base Therapy of Pain with Magnesium Sulfate on the Trigger Axis of the TNF-α-TRAF6-NF-κB and Its Inhibitor (miR-146a-5p) in Rats.
Bagheri GR, Poursamimi J, Ali-Anvari H … +2 more , Rashki Ghalenoo S, Ghaffari HR
Iran J Allergy Asthma Immunol · 2025 Mar · PMID 40211498 · Publisher ↗
europathic pain can arise from injury or illness affecting the somatosensory system. It can also be triggered by cancer or chemotherapy drugs like paclitaxel. Researchers have indicated that magnesium sulfate may help in...
europathic pain can arise from injury or illness affecting the somatosensory system. It can also be triggered by cancer or chemotherapy drugs like paclitaxel. Researchers have indicated that magnesium sulfate may help in preventing neuropathy. This study aimed to investigate the effect of magnesium sulfate on paclitaxel-induced neuropathic pain by inhibiting the Tumor Necrosis Factor (TNF) Alpha - receptor-associated factor 6 - Nuclear factor kappa-light-chain-enhancer of activated B cells (TNF-α-TRAF6-NF-κB) axis. Twenty-four male rats were divided into four groups: experiment group (E)-1, E2, E3, and the control group (Co). The experimental groups and the control group received paclitaxel at a dosage of 8 mg/kg every other day, totaling four injections over seven days. In addition, magnesium sulfate was administered daily in three doses of 300, 150, and 75 mg/kg, amounting to seven injections over the course of seven days. On the seventh day, peripheral blood samples were collected from the rats, and sera were used for the analysis of TNF-α serum levels and MicroRNA-146a-5p expression using ELISA and qRT-PCR methods, respectively. The serum levels of TNF-α increased in the E1, E2, and E3 groups compared to the control group. However, there was a gradual decrease in the E1, E2 and E3 groups. The miR-146a-5p expression declined in the E1 group and increased in the E2 and E3 groups compared to the control group. This study demonstrated that administering 300 and 150 mg of magnesium sulfate decreased TNF-α synthesis and reduced the function of the TNF-α-TRAF6-NF-κB axis during the initiation step.
The Association of Monocyte Subtypes Frequency and Serum TNF-α and TGF-β Levels with Diabetic Wound Grade.
Asghariazar V, Dolatkhah R, Moharami S … +4 more , Iranpour S, Adli A, Eterafi M, Safarzadeh E
Iran J Allergy Asthma Immunol · 2025 Mar · PMID 40211497 · Publisher ↗
The exact mechanisms underlying impaired wound healing in diabetes are not fully understood. In this study, we aimed to investigate the effect of classical and non-classical monocyte ratios along with TNF-α and TGF-β pla...
The exact mechanisms underlying impaired wound healing in diabetes are not fully understood. In this study, we aimed to investigate the effect of classical and non-classical monocyte ratios along with TNF-α and TGF-β plasma levels on diabetic wound healing. Twenty-four patients with confirmed type 2 diabetes and twenty healthy controls were enrolled in this study. The peripheral blood mononuclear cells (PBMC) isolation was performed by Ficoll-Paque density gradient centrifugation method. The frequency of different subsets of monocytes was characterized in diabetic patients and healthy controls using flow cytometry. TNF-α and TGF-β plasma levels were measured by the enzyme-linked immunosorbent assay (ELISA) method. We found a significant difference in the frequency of classical and non-classical monocytes in healthy controls and diabetic patients. The plasma level of TNF-α was higher in diabetic patients than in healthy controls, and its level was associated with wound grade. Moreover, the plasma level of TGF-β was lower in diabetic patients rather than healthy controls. Also, our data showed a higher percentage of non-classical monocytes as wound grade increased. In conclusion, the wound healing process is affected by diabetes via changes in non-classical and classical monocyte percentages, which may be the result of TNF-α increase and TGF-β levels decreasing in diabetic patients' plasma.
Are Asthma and COPD Risk Factors for Poor Outcomes in COVID-19? A Single-center Observational Study in the South of Iran.
Jabbari L, Mohammadi Pashtooi M, Alipour Z … +2 more , Hosseini Teshnizi S, Hayati S
Iran J Allergy Asthma Immunol · 2025 Mar · PMID 40211496 · Publisher ↗
Asthma and Chronic Obstructive Pulmonary Disease (COPD) are prevalent chronic respiratory conditions that may impact clinical outcomes in patients with COVID-19. This study aimed to evaluate the influence of asthma and C...
Asthma and Chronic Obstructive Pulmonary Disease (COPD) are prevalent chronic respiratory conditions that may impact clinical outcomes in patients with COVID-19. This study aimed to evaluate the influence of asthma and COPD on the outcomes of hospitalized COVID-19 patients. This retrospective observational study, conducted in 2021 at Shahid Mohammadi Hospital, Bandar Abbas, Iran, included 1777 COVID-19 patients. Data on demographics, comorbidities, and clinical parameters were retrieved from the hospital's COVID-19 registry. Logistic regression analysis was used to evaluate the impact of asthma and COPD on clinical outcomes. Asthma was diagnosed in 83 patients (4.7%) and COPD in 19 patients (1.0%), with a mean age of 50.5 ± 17.5 years. The mortality rate was highest in the COPD group (31.6%), followed by the asthma group (20.5%) and the group without obstructive diseases (13.5%). No significant differences were found in intensive care unit (ICU) admission, mechanical ventilation, or mortality associated with asthma or COPD. Age and comorbidities were significant factors influencing mortality. This study found no significant impact of asthma or COPD on ICU admission, mechanical ventilation, or mortality rates among hospitalized COVID-19 patients.
Serum Exosomal Expression of miR-155 and miR-221 in Moderate-to-severe Asthmatic Patients.
Rostamzadeh Khoie Z, Dezfuli NK, Varahram M … +5 more , Fakharian A, Mahdaviani SA, Jamaati H, Adcock IM, Mortaz E
Iran J Allergy Asthma Immunol · 2025 Mar · PMID 40211495 · Publisher ↗
The cardinal features of asthma include airway inflammation, airway hyper responsiveness (AHR) and airway remodeling. Exosomes help orchestrate the immune response and contain microRNAs (miRNAs) such as miRNA-155 and miR...
The cardinal features of asthma include airway inflammation, airway hyper responsiveness (AHR) and airway remodeling. Exosomes help orchestrate the immune response and contain microRNAs (miRNAs) such as miRNA-155 and miRNA-221 which play significant roles in the pathogenesis and exacerbations of severe asthma. In this study, we aimed to investigate the exosomal expression of miRNAs (155, 221) in the serum of severe asthma patients. Eighteen moderate-to-severe asthma patients and eighteen healthy subjects were recruited for this study. Serum exosomes were isolated and characterized according to their shape, size, and exosomal markers by transmission electron microscopy, dynamic light scattering (DLS) and flow cytometry, respectively. Exosomal miRNA extraction and quantitative real-time PCR (qRT-PCR) were used to measure miR-155 and miR-221. Besides the forced expiratory volume in 1 second and forced vital capacity (FVC) were evaluated in the patient groups. Round exosomes with a mean size of 25.8 nm were isolated from serum of asthmatic patients. Flow cytometry shows high expression of CD63 and CD81 on isolated exosomes. Serum exosomes from severe asthma patients and healthy donors contained miR-155 and miR-221 but miR-155 and miR-221 expression levels were significantly increased in severe asthma patients. There was a positive correlation between miR-221 expression and FVC). Receiver operating characteristic (ROC) analysis indicated that miR-155 and miR-221 had an excellent diagnostic efficiency in predicting asthma (AUC=0.91 and AUC=0.76, respectively). Serum exosomal miR-155 and miR-221 may be a potential biomarker for severe asthma. However, the results need to be validated in another cohort, and further studies with larger samples size should be conducted on the effects of these miRNAs on effector cells.
Clinical Efficacy and Influencing Factors of Budesonide Inhalation in the Treatment of Cough Variant Asthma in Adults.
Zhang J, Jiang X, Lei Z
Iran J Allergy Asthma Immunol · 2025 Mar · PMID 40211494 · Publisher ↗
OBJECTIVE: To analyze the clinical efficacy and influencing factors of budesonide inhalation therapy in adult Cough variant asthma (CVA). METHODS: This retrospective study involved 223 CVA patients who were treated in...
OBJECTIVE: To analyze the clinical efficacy and influencing factors of budesonide inhalation therapy in adult Cough variant asthma (CVA). METHODS: This retrospective study involved 223 CVA patients who were treated in the hospital from January 2022 to February 2024. These patients received standard symptomatic treatment (such as cough suppression, expectoration, and anti-infection therapies), along with budesonide inhalation therapy. The main objective of the study was to evaluate the clinical effects before and after treatment, including lung function, serum inflammatory factor levels, and immune function, while also recording any adverse reactions that occurred during treatment. We classified the patients into effective and ineffective groups based on treatment outcomes, collected clinical factors related to efficacy, and used logistic regression analysis to investigate the factors affecting treatment effectiveness. RESULTS: After treatment, the lung function indicators of patients showed significant improvement, with the forced expiratory volume in one second (FEV1), forced vital capacity (FVC), and peak expiratory flow (PEF) all increasing compared to before treatment. At the same time, the levels of tumor necrosis factor-alpha (TNF-α), interleukin-4 (IL-4), and immunoglobulin E (IgE) in the serum decreased. In terms of immune function, the levels of CD3+ and CD4+ cells were increased, while the level of CD8+ cells decreased. Thirteen patients (5.83%) experienced nausea and indigestion during the treatment process, nine patients (4.04%) had drowsiness and fatigue, and seven patients (3.14%) had discomfort in the throat. Based on the therapeutic efficacy evaluation after treatment, patients were divided into an effective group (n=188) and an ineffective group (n=35). Further multivariate logistic regression analysis revealed that older age (OR=1.570), lower levels of 25-hydroxyvitamin D3 [25(OH)D3] (OR=0.798), and high levels of tumor necrosis factor-alpha (TNF-α) (OR=1.850) increased the risk of reduced therapeutic efficacy. CONCLUSION: Budenoside inhalation therapy is effective for CVA patients, as it can improve lung function, reduce inflammation, and enhance immune function. However, factors such as age, 25(OH)D3, and TNF-α may influence the treatment outcomes.
Predictive Value of the Lung Immune Prognostic Index for Immune Checkpoint Inhibitor Therapy Outcomes in Non-Small Cell Lung Cancer: A Systematic Review and Meta-Analysis.
Lu W, Su J
Iran J Allergy Asthma Immunol · 2025 Mar · PMID 40211493 · Publisher ↗
Non-Small Cell Lung Cancer (NSCLC) patients undergoing Immune Checkpoint Inhibitors (ICIs) therapy exhibit diverse clinical outcomes. The Lung Immune Prognostic Index (LIPI) may emerge as a potential prognostic marker. T...
Non-Small Cell Lung Cancer (NSCLC) patients undergoing Immune Checkpoint Inhibitors (ICIs) therapy exhibit diverse clinical outcomes. The Lung Immune Prognostic Index (LIPI) may emerge as a potential prognostic marker. This study systematically reviews and meta-analyzes the prognostic value of LIPI in predicting the clinical efficacy of ICIs therapy for NSCLC patients. A thorough literature review was performed using the Cochrane Library, Web of Science, PubMed, and Embase, following PRISMA guidelines. Studies assessing LIPI's predictive value in NSCLC patients treated with ICIs were included. Effect sizes were aggregated utilizing a fixed-effects model. The studies featured in the review were appraised using the Newcastle-Ottawa Scale for quality assessment. Eight studies were incorporated into the meta-analysis, encompassing various treatment lines and ICIs. No substantial heterogeneity was detected across the studies. The meta-analysis revealed that the low-risk group exhibited significantly extended overall survival (OS) (HR=3.18, 95%CI: 2.78~3.59 and progression-free survival (PFS) (HR=1.60, 95%CI: 1.4~61.74, underscoring the predictive significance of LIPI for NSCLC patients treated with ICI therapy. No significant publication bias was detected. LIPI demonstrates potential as a prognostic marker for NSCLC patients receiving ICI therapy, contributing to the development of therapeutic strategies. Further prospective researches are required to investigate its relationship with factors such as tumor mutational burden, PD-L1 and PD-1.
About
- Frequency
- Sun
- Papers found
- 200
- RSS feed
- Subscribe