Journal Of Clinical & Experimental Ophthalmology[JOURNAL]
Sun
200 papers
Association between in vitro susceptibility to natamycin and voriconazole and clinical outcomes in fungal keratitis.
Sun CQ, Lalitha P, Prajna NV … +9 more , Karpagam R, Geetha M, O'Brien KS, Oldenburg CE, Ray KJ, McLeod SD, Acharya NR, Lietman TM, Mycotic Ulcer Treatment Trial Group
Ophthalmology · 2014 Aug · PMID 24746358 · Full text
PURPOSE: To assess the association between minimum inhibitory concentration (MIC) and clinical outcomes in a fungal keratitis clinical trial. DESIGN: Experimental study using data from a randomized comparative trial. PAR...
PURPOSE: To assess the association between minimum inhibitory concentration (MIC) and clinical outcomes in a fungal keratitis clinical trial. DESIGN: Experimental study using data from a randomized comparative trial. PARTICIPANTS: Of the 323 patients enrolled in the trial, we were able to obtain MIC values from 221 patients with monocular fungal keratitis. METHODS: The Mycotic Ulcer Treatment Trial I was a randomized, double-masked clinical trial comparing clinical outcomes of monotherapy with topical natamycin versus voriconazole for the treatment of fungal keratitis. Speciation and determination of MIC to natamycin and voriconazole were performed according to Clinical and Laboratory Standards Institute guidelines. The relationship between MIC and clinical outcome was assessed. MAIN OUTCOME MEASURES: The primary outcome was 3-month best spectacle-corrected visual acuity. Secondary outcomes included 3-month infiltrate or scar size; corneal perforation and/or therapeutic penetrating keratoplasty; and time to re-epithelialization. RESULTS: A 2-fold increase in MIC was associated with a larger 3-month infiltrate or scar size (0.21 mm; 95% confidence interval [CI], 0.10-0.31; P < 0.001) and increased odds of perforation (odds ratio, 1.32; 95% CI, 1.04-1.69; P = 0.02). No correlation was found between MIC and 3-month visual acuity. For natamycin-treated cases, an association was found between higher natamycin MIC with larger 3-month infiltrate or scar size (0.29 mm; 95% CI, 0.15-0.43; P < 0.001) and increased perforations (odds ratio, 2.41; 95% CI, 1.46-3.97; P < 0.001). Among voriconazole-treated cases, the voriconazole MIC did not correlate with any of the measured outcomes in the study. CONCLUSIONS: Decreased susceptibility to natamycin was associated with increased infiltrate or scar size and increased odds of perforation. There was no association between susceptibility to voriconazole and outcome.
Corneal biomechanical properties in different ocular conditions and new measurement techniques.
Garcia-Porta N, Fernandes P, Queiros A … +3 more , Salgado-Borges J, Parafita-Mato M, González-Méijome JM
ISRN Ophthalmol · 2014 · PMID 24729900 · Full text
Several refractive and therapeutic treatments as well as several ocular or systemic diseases might induce changes in the mechanical resistance of the cornea. Furthermore, intraocular pressure measurement, one of the most...
Several refractive and therapeutic treatments as well as several ocular or systemic diseases might induce changes in the mechanical resistance of the cornea. Furthermore, intraocular pressure measurement, one of the most used clinical tools, is also highly dependent on this characteristic. Corneal biomechanical properties can be measured now in the clinical setting with different instruments. In the present work, we review the potential role of the biomechanical properties of the cornea in different fields of ophthalmology and visual science in light of the definitions of the fundamental properties of matter and the results obtained from the different instruments available. The body of literature published so far provides an insight into how the corneal mechanical properties change in different sight-threatening ocular conditions and after different surgical procedures. The future in this field is very promising with several new technologies being applied to the analysis of the corneal biomechanical properties.
Macular corneal dystrophy: in vivo confocal and structural data.
Micali A, Pisani A, Puzzolo D … +7 more , Nowińska A, Wylegala E, Teper S, Czajka E, Roszkowska AM, Orzechowska-Wylegala B, Aragona P
Ophthalmology · 2014 Jun · PMID 24491640 · Publisher ↗
OBJECTIVE: To demonstrate the corneal morphologic aspects obtained with in vivo confocal microscopy (CM) and light and electron microscopy of specimens obtained from the same patients with macular corneal dystrophy (MCD)...
OBJECTIVE: To demonstrate the corneal morphologic aspects obtained with in vivo confocal microscopy (CM) and light and electron microscopy of specimens obtained from the same patients with macular corneal dystrophy (MCD). DESIGN: Case series. PARTICIPANTS: Five consecutive patients affected by MCD undergoing penetrating keratoplasty (PK) in 1 eye. METHODS: The patients were examined with the slit-lamp, optical pachymetry, and CM before undergoing PK. The corneal buttons were processed for light, transmission, and scanning electron microscopy. MAIN OUTCOME MEASURES: Corneal in vivo CM, corneal light, and electron microscopy. RESULTS: Confocal microscopy showed areas of altered reflectivity in basal epithelial cells, which appeared hyperreflective or completely white. In the anterior stroma, rectilinear hyperreflective areas were shown. The stroma was characterized by a granular appearance of both keratocytes and extracellular matrix. Dark striae of different length and orientation were present in the middle and posterior stroma. The corneal endothelium showed polymegethism and cells containing bright granules in their cytoplasm. The histopathologic study demonstrated areas of thickened Bowman's layer covered by an epithelium reduced in height. The Bowman's layer thickenings were due to the accumulation of free or vesiculated material of different electron density. The keratocytes showed intracytoplasmatic vesicles, whereas the extracellular matrix presented a large quantity of intercellular electron-lucent material and parallel lamellae with an undulated course. Occasional macrophages, filled with vesicles of granular-filamentous material and evident podosomes, were observed. Descemet's membrane was formed by a normal anterior banded zone and a posterior nonbanded zone of honeycombed aspect. The endothelial cells showed a large number of intracytoplasmic vesicles. CONCLUSIONS: The structural changes observed with the histopathologic methods give an account and provide an explanation for the pathologic changes demonstrated by CM in the course of MCD. This may contribute to the understanding of in vivo imaging, allowing a better, noninvasive study of the disease evolution.
Lacrimal gland pleomorphic adenoma and carcinoma ex pleomorphic adenoma: genomic profiles, gene fusions, and clinical characteristics.
von Holstein SL, Fehr A, Persson M … +5 more , Nickelsen M, Therkildsen MH, Prause JU, Heegaard S, Stenman G
Ophthalmology · 2014 May · PMID 24468654 · Publisher ↗
PURPOSE: To study genetic alterations in lacrimal gland pleomorphic adenoma (PA) and carcinoma ex pleomorphic adenoma (Ca-ex-PA) with focus on copy number changes and expression patterns of the translocation target genes...
PURPOSE: To study genetic alterations in lacrimal gland pleomorphic adenoma (PA) and carcinoma ex pleomorphic adenoma (Ca-ex-PA) with focus on copy number changes and expression patterns of the translocation target genes PLAG1, HMGA2, and CRTC1-MAML2 in relation to clinical data. DESIGN: Experimental study. PARTICIPANTS: A total of 36 tumors from 32 patients with lacrimal gland PA or Ca-ex-PA were included in the study. METHODS: Genome wide, high-resolution array-based comparative genomic hybridization (arrayCGH) and immunohistochemistry were used to study the genomic profiles and expression patterns of the translocation targets PLAG1, HMGA2, and CRTC1-MAML2. MAIN OUTCOME MEASURES: Copy number alterations (gains/losses) and protein expression of PLAG1, HMGA2, and CRTC1-MAML2. RESULTS: Genome-wide arrayCGH analysis revealed normal genomic profiles in 10 of 17 PA samples. The average number of genomic imbalances per tumor was 3.25 (range, 1-7) in primary and recurrent PAs with alterations compared with 7.7 (range, 4-12) in Ca-ex-PAs. Five recurrent copy number alterations were identified in PAs, including losses of 1pter-p31.3, 6q22.1-q24.3, 8q24.22-q24.3, and 13q21.31-q21.33, and gain of 9p23-p22.3. Gain of 9p23-p22.3 also was seen in a Ca-ex-PA. In Ca-ex-PA, gain of 22q12.3-qter was the only recurrent alteration. Detailed analysis of the array data identified NFIB and PDGFB as the 2 major candidate target oncogenes that may be activated as a result of copy number gains involving 9p and 22q. Both genes have been implicated in the pathogenesis of PA and other types of salivary gland tumors. Immunohistochemical analysis revealed frequent overexpression of the translocation target gene PLAG1 in PAs and in 1 Ca-ex-PA. In contrast, overexpression of HMGA2 was observed in only a small subset of PAs. The CRTC1-MAML2 fusion oncoprotein was overexpressed in 2 mucoepidermoid Ca-ex-PAs. CONCLUSIONS: Lacrimal and salivary gland PAs and Ca-ex-PAs have similar genomic profiles and frequently overexpress the PLAG1 oncoprotein. Copy number gains involving 9p23-p22.3 (NFIB) and 22q12-qter (PDGFB) may be of importance for disease progression in a subset of lacrimal gland PAs.
Pharmacogenetic associations with vascular endothelial growth factor inhibition in participants with neovascular age-related macular degeneration in the IVAN Study.
Lotery AJ, Gibson J, Cree AJ … +7 more , Downes SM, Harding SP, Rogers CA, Reeves BC, Ennis S, Chakravarthy U, Alternative Treatments to Inhibit VEGF in Patients with Age-Related Choroidal Neovascularisation (IVAN) Study Group
Ophthalmology · 2013 Dec · PMID 24070809 · Publisher ↗
PURPOSE: To determine if prespecified genetic polymorphisms influence responsiveness to vascular endothelial growth factor (VEGF) inhibition in neovascular age-related macular degeneration (nAMD). The objectives were to...
PURPOSE: To determine if prespecified genetic polymorphisms influence responsiveness to vascular endothelial growth factor (VEGF) inhibition in neovascular age-related macular degeneration (nAMD). The objectives were to replicate 3 reported pharmacogenetic associations of response in nAMD and to test for novel associations. DESIGN: Cohort study, combining information about patients' genotypes with information from a randomized controlled trial about responsiveness to anti-VEGF therapy for nAMD. PARTICIPANTS: Five hundred nine participants with nAMD, enrolled in the Alternative Treatments to Inhibit VEGF in Patients with Age-Related Choroidal Neovascularisation (IVAN) trial. METHODS: Participants were classified as responders or nonresponders to VEGF inhibition based on the optical coherence tomography (OCT) metric of total retinal thickness (TRT). We computed the change in TRT from baseline to the latest time point for which OCT data were available (3, 6, 9, or 12 months). Eyes with changes in TRT greater than or equal to the 75th percentile or more were classified as responders, and those with changes less than or equal to the 25th percentile or lower were classified as non-responders. Three previously reported associations of response to VEGF inhibition in nAMD involving single nucleotide polymorphisms (SNPs) at the CFH, FZD4, and HTRA1/ARMS2 loci were tested for replication. An additional 482 SNPs also were tested using a candidate gene approach. Associations were estimated as odds ratios (ORs) with confidence intervals (CIs). MAIN OUTCOME MEASURES: The primary outcome was evidence of a genetic association with response to VEGF inhibition as measured by change in TRT. RESULTS: One hundred twenty-six participants were classified as responders and 128 were classified as nonresponders. The SNP rs10490924 in HTRA1/ARMS2 showed a borderline association with responsiveness after Bonferroni correction (OR, 1.53; CI, 0.99-2.36; P = 0.055, Bonferroni correction). None of the other 484 additional SNPs tested for association was significant after Bonferroni correction for multiple testing. The smallest corrected P value was 0.84 (P = 0.002, uncorrected) for rs9679290 in the EPAS1 (HIF2A) gene on chromosome 2. Four of the 10 most significant results were in this gene. CONCLUSIONS: We estimated pharmacogenetic associations using high-quality phenotype data from a randomized controlled clinical trial of nAMD. No significant association or replication of previous associations were observed. Further investigation of the EPAS1 (HIF2A) gene, however, may, be merited.
Working-age cataract patients: visual results, reading performance, and quality of life with three diffractive multifocal intraocular lenses.
Cillino G, Casuccio A, Pasti M … +3 more , Bono V, Mencucci R, Cillino S
Ophthalmology · 2014 Jan · PMID 23953097 · Publisher ↗
PURPOSE: To compare the visual outcomes, reading performance, and quality of life (QoL) of working-age cataractous patients bilaterally implanted with 3 different diffractive multifocal intraocular lenses (MIOLs). DESIGN...
PURPOSE: To compare the visual outcomes, reading performance, and quality of life (QoL) of working-age cataractous patients bilaterally implanted with 3 different diffractive multifocal intraocular lenses (MIOLs). DESIGN: Two-center, randomized, prospective, double-masked study. PARTICIPANTS: Sixty-three consecutive patients (126 eyes) seen at Ophthalmology Section, Palermo and Florence University, Italy, randomized to receive the ReSTOR SN6AD3 (Alcon Laboratories, Inc, Irvine, CA) (20 patients, group A), ReSTOR SN6AD1 (Alcon Laboratories, Inc) (21 patients, group B), or TECNIS ZMA00 (Abbott Medical Optics, Santa Ana, CA) (22 patients, group C) MIOL. INTERVENTION: Phacoemulsification. MAIN OUTCOME MEASURES: One-year follow-up differences among the 3 MIOL groups in visual acuity, reading performance by MNREAD (Minnesota Laboratory for Low-Vision Research, University of Minnesota, Minneapolis, MN) reading acuity (RA), critical print size (CPS), and maximum reading speed (MRS) under mesopic and photopic conditions. SECONDARY OUTCOME MEASURES: Photopic and mesopic contrast sensitivity (CS) by Pelli-Robson test and patient satisfaction by National Eye Institute Refractive Error Quality of Life Instrument-42 (NEI RQL-42) questionnaire. RESULTS: Mean photopic uncorrected near visual acuity (UNVA), distance-corrected near visual acuity (DCNVA), and corrected near visual acuity (CNVA) did not differ among groups, with a preferred reading distance greater in group B (P< 0.0005). Photopic distance-corrected intermediate visual acuity (DCIVA) was best in group B (P = 0.001) and better in group C than in group A. Mesopic UNVA and DCNVA were worse in groups A and B compared with group C (P< 0.0005 in both cases), with better DCNVA in group B than in group A (P = 0.031). Mesopic uncorrected intermediate visual acuity (UIVA) and DCIVA were worst in group A, with better results in group C (P< 0.0005 and P = 0.001, respectively). Mesopic MNREAD RA was better in group C (P = 0.02), and mesopic MRS was higher in groups B and C than in group A (P = 0.002). The QoL scores by the NEI RQL-42 test exhibited no differences among groups in 9 over 13 scales. "Near vision" (P = 0.005), "symptoms" (P = 0.001), and "satisfaction with correction" scale scores (P = 0.030) were lowest in group A, and "appearance" scale score was lowest in group B (P = 0.045). CONCLUSIONS: Newer-generation aspheric diffractive MIOLs, especially low-add hybrid apodized or full diffractive, are highly suited for working-age cataractous patients in terms of visual outcomes, reading performance, and QoL. Intrinsic optical differences, such as optimization for computer or dim-light working, or night driving, could be useful tools to customize the IOL in each single case.
Adenoid cystic carcinoma of the lacrimal gland: MYB gene activation, genomic imbalances, and clinical characteristics.
von Holstein SL, Fehr A, Persson M … +4 more , Therkildsen MH, Prause JU, Heegaard S, Stenman G
Ophthalmology · 2013 Oct · PMID 23725736 · Publisher ↗
PURPOSE: To investigate genetic alterations in lacrimal gland adenoid cystic carcinomas (ACCs) with emphasis on the MYB-NFIB fusion oncogene and its downstream targets, MYB rearrangements, and copy number alterations in...
PURPOSE: To investigate genetic alterations in lacrimal gland adenoid cystic carcinomas (ACCs) with emphasis on the MYB-NFIB fusion oncogene and its downstream targets, MYB rearrangements, and copy number alterations in relation to clinical data and survival. DESIGN: Experimental study. PARTICIPANTS AND CONTROLS: Fourteen patients with primary lacrimal gland ACC were included. As a control, we also studied the expression of MYB-NFIB in 19 non-ACC lacrimal gland tumors. METHODS: The expression and identity of MYB-NFIB fusion transcripts were studied using reverse transcriptase polymerase chain reaction (RT-PCR) and nucleotide sequence analyses. Quantitative polymerase chain reaction (PCR) and immunohistochemistry were used to evaluate the expression of MYB/MYB-NFIB target genes. High-resolution array-based comparative genomic hybridization (arrayCGH) and fluorescence in situ hybridization were used to study copy number alterations and MYB rearrangements. MAIN OUTCOME MEASURES: mRNA or protein expression of MYB-NFIB, MYB, and its down stream targets; copy number alterations; and genomic rearrangements. RESULTS: The median age of the patients was 43 years (equal gender distribution), and the median time of survival was 8.6 years. The MYB-NFIB fusion was expressed in 7 of 14 ACCs. In contrast, all non-ACC tumors were fusion-negative. All 13 ACCs tested stained positive for the MYB protein, and for the MYB targets KIT and BCL2, 12 were positive for MYC and CCNE1, and 9 were positive for CCNB1. Rearrangements of MYB were detected in 8 of 13 cases, including 2 cases with gain of an apparently intact MYB gene. The arrayCGH analysis revealed recurrent copy number alterations with losses involving 6q23-q27, 12q12-q14.1, and 17p13.3-p12, and gains involving 19q12, 19q13.31-qter, 8q24.13-q24.21, 11q12.3-q14.1, and 6q23.3. Neither MYB-NFIB fusion nor any copy number alteration correlated with survival. CONCLUSIONS: Lacrimal gland ACCs are frequently positive for the MYB-NFIB fusion, overexpress MYB and its downstream targets, and have genomic profiles characterized by losses involving 6q, 12q, and 17p, and gains involving 19q, 8q, and 11q. Our findings show that lacrimal gland ACCs are genetically and clinically similar to their salivary gland counterparts and that MYB-NFIB is a clinically useful diagnostic biomarker for ACC. Our data also suggest that MYB and its downstream targets are potential therapeutic targets for these tumors. FINANCIAL DISCLOSURE(S): The author(s) have no proprietary or commercial interest in any materials discussed in this article.
Human corneal anatomy redefined: a novel pre-Descemet's layer (Dua's layer).
Dua HS, Faraj LA, Said DG … +2 more , Gray T, Lowe J
Ophthalmology · 2013 Sep · PMID 23714320 · Publisher ↗
PURPOSE: To define and characterize a novel pre-Descemet's layer in the human cornea. DESIGN: Clinical and experimental study. PARTICIPANTS: We included 31 human donor sclerocorneal discs, including 6 controls (mean age,...
PURPOSE: To define and characterize a novel pre-Descemet's layer in the human cornea. DESIGN: Clinical and experimental study. PARTICIPANTS: We included 31 human donor sclerocorneal discs, including 6 controls (mean age, 77.7 years). METHODS: Air was injected into the stroma of donor whole globes (n = 4) and sclerocorneal discs (n = 21) as in the clinical deep anterior lamellar keratoplasty procedure with the big bubble (BB) technique. The following experiments were performed: (1) creation of BB followed by peeling of the Descemet's membrane (DM); (2) peeling off of the DM followed by creation of the BB, and (3) creation of the BB and continued inflation until the bubble popped to measure the popping pressure. Tissue obtained from these experiments was subjected to histologic examination. MAIN OUTCOME MEASURES: Demonstration of a novel pre-Descemet's layer (Dua's layer) in the human cornea. RESULTS: Three types of BB were obtained. Type-1, is a well-circumscribed, central dome-shaped elevation up to 8.5 mm in diameter (n = 14). Type-2, is a thin-walled, large BB of maximum 10.5 mm diameter, which always started at the periphery, enlarging centrally to form a large BB (n = 5), and a mixed type (n = 3). With type-1 BB, unlike type-2 BB, it was possible to peel off DM completely without deflating the BB, indicating the presence of an additional layer of tissue. A type-1 BB could be created after first peeling off the DM (n = 5), confirming that DM was not essential to create a type-1 BB. The popping pressure was 1.45 bar and 0.6 bar for type-1 BB and type-2 BB, respectively. Histology confirmed that the cleavage occurred beyond the last row of keratocytes. This layer was acellular, measured 10.15 ± 3.6 microns composed of 5 to 8 lamellae of predominantly type-1 collagen bundles arranged in transverse, longitudinal, and oblique directions. CONCLUSIONS: There exists a novel, well-defined, acellular, strong layer in the pre-Descemet's cornea. This separates along the last row of keratocytes in most cases performed with the BB technique. Its recognition will have considerable impact on posterior corneal surgery and the understanding of corneal biomechanics and posterior corneal pathology such as acute hydrops, Descematocele and pre-Descemet's dystrophies. FINANCIAL DISCLOSURE(S): The authors have no proprietary or commercial interest in any materials discussed in this article.
Age-related macular degeneration and modification of systemic complement factor H production through liver transplantation.
Khandhadia S, Hakobyan S, Heng LZ … +12 more , Gibson J, Adams DH, Alexander GJ, Gibson JM, Martin KR, Menon G, Nash K, Sivaprasad S, Ennis S, Cree AJ, Morgan BP, Lotery AJ
Ophthalmology · 2013 Aug · PMID 23562165 · Publisher ↗
PURPOSE: To investigate whether modification of liver complement factor H (CFH) production, by alteration of liver CFH Y402H genotype through liver transplantation (LT), influences the development of age-related macular...
PURPOSE: To investigate whether modification of liver complement factor H (CFH) production, by alteration of liver CFH Y402H genotype through liver transplantation (LT), influences the development of age-related macular degeneration (AMD). DESIGN: Multicenter, cross-sectional study. PARTICIPANTS: We recruited 223 Western European patients ≥ 55 years old who had undergone LT ≥ 5 years previously. METHODS: We determined AMD status using a standard grading system. Recipient CFH Y402H genotype was obtained from DNA extracted from recipient blood samples. Donor CFH Y402H genotype was inferred from recipient plasma CFH Y402H protein allotype, measured using enzyme-linked immunosorbent assays. This approach was verified by genotyping donor tissue from a subgroup of patients. Systemic complement activity was ascertained by measuring levels of plasma complement proteins using an enzyme-linked immunosorbent assay, including substrates (C3, C4), activation products (C3a, C4a, and terminal complement complex), and regulators (total CFH, C1 inhibitor). MAIN OUTCOME MEASURES: We evaluated AMD status and recipient and donor CFH Y402H genotype. RESULTS: In LT patients, AMD was associated with recipient CFH Y402H genotype (P = 0.036; odds ratio [OR], 1.6; 95% confidence interval [CI], 1.0-2.4) but not with donor CFH Y402H genotype (P = 0.626), after controlling for age, sex, smoking status, and body mass index. Recipient plasma CFH Y402H protein allotype predicted donor CFH Y402H genotype with 100% accuracy (n = 49). Plasma complement protein or activation product levels were similar in LT patients with and without AMD. Compared with previously reported prevalence figures (Rotterdam Study), LT patients demonstrated a high prevalence of both AMD (64.6% vs 37.1%; OR, 3.09; P<0.001) and the CFH Y402H sequence variation (41.9% vs 36.2%; OR, 1.27; P = 0.014). CONCLUSIONS: Presence of AMD is not associated with modification of hepatic CFH production. In addition, AMD is not associated with systemic complement activity in LT patients. These findings suggest that local intraocular complement activity is of greater importance in AMD pathogenesis. The high AMD prevalence observed in LT patients may be associated with the increased frequency of the CFH Y402H sequence variation. FINANCIAL DISCLOSURE(S): The authors have no proprietary or commercial interest in any materials discussed in this article.
Effect of day length on eye growth, myopia progression, and change of corneal power in myopic children.
Cui D, Trier K, Munk Ribel-Madsen S
Ophthalmology · 2013 May · PMID 23380471 · Publisher ↗
OBJECTIVE: Because of the northern location of Denmark, the length of the day over the year varies from 7 to 17.5 hours. Experimental and clinical results suggest that the development of myopia may be related to ambient...
OBJECTIVE: Because of the northern location of Denmark, the length of the day over the year varies from 7 to 17.5 hours. Experimental and clinical results suggest that the development of myopia may be related to ambient light exposure. The purpose of current study was to investigate whether axial eye growth, myopia progression, or corneal power change in Danish myopic children varies with the length of the day. DESIGN: Cross-sectional study. PARTICIPANTS: Two hundred thirty-five children 8 to 14 years of age found to have myopia during screening for a clinical trial (ClinicalTrial.gov identifier, NCT00263471; accessed December 6, 2005). All children found to have any value of spherical equivalent that was myopic (<0 diopters [D]) at the first of 2 visits were included. METHODS: Cycloplegic refraction was measured using an autorefractor, axial eye length, and corneal power using an automatic combined noncontact partial coherence interferometer and keratometer. The accumulated number of daylight hours during the measurement period was calculated for each participant using an astronomical table. MAIN OUTCOME MEASURES: Change over 6 months in axial length, refraction, and corneal power. RESULTS: Accumulated hours of daylight ranged from 1660 to 2804 hours. Significant correlations were found between hours of daylight and eye elongation (P = 0.00), myopia progression (P = 0.01), and corneal power change (P = 0.00). In children with an average of 2782 ± 19 hours of daylight, axial eye growth was 0.12 ± 0.09 mm, myopia progression was 0.26 ± 0.27 D, and corneal power change was 0.05 ± 0.10 D per 6 months, whereas in children with an average of 1681 ± 24 hours of daylight, axial eye growth was 0.19 ± 0.10 mm, myopia progression was 0.32 ± 0.27 D, and corneal power change was -0.04 ± 0.08 D per 6 months. CONCLUSIONS: Eye elongation and myopia progression seem to decrease in periods with longer days and to increase in periods with shorter days. Children should be encouraged to spend more time outside during daytime to prevent myopia. FINANCIAL DISCLOSURE(S): The author(s) have no proprietary or commercial interest in any materials discussed in this article.
Histologic basis of variations in retinal pigment epithelium autofluorescence in eyes with geographic atrophy.
Rudolf M, Vogt SD, Curcio CA … +5 more , Huisingh C, McGwin G, Wagner A, Grisanti S, Read RW
Ophthalmology · 2013 Apr · PMID 23357621 · Full text
PURPOSE: Lipofuscin contained in the retinal pigment epithelium (RPE) is the main source of fundus autofluorescence (FAF), the target of an imaging method useful for estimating the progression of geographic atrophy (GA)...
PURPOSE: Lipofuscin contained in the retinal pigment epithelium (RPE) is the main source of fundus autofluorescence (FAF), the target of an imaging method useful for estimating the progression of geographic atrophy (GA) in clinical trials. To establish a cellular basis for hyperfluorescent GA border zones, histologic autofluorescence (HAF) was measured at defined stages of RPE pathologic progression. DESIGN: Experimental study. PARTICIPANTS AND CONTROLS: Ten GA donor eyes (mean age ± standard deviation, 87.1 ± 4.0 years) and 3 age-matched control eyes (mean age ± standard deviation, 84.0 ± 7.2 years) without GA. METHODS: The 10-micrometer-thick sections were divided into zones of RPE morphologic features according to an 8-point scale. Any HAF excited by 488 nm light was imaged by laser confocal microscopy. The HAF intensity summed along vertical lines perpendicular to Bruch's membrane at 0.2-μm intervals served as a surrogate for FAF. Intensity profiles in 151 zones were normalized to grade 0 at a standard reference location in each eye. Cross-sectional area, mean, and sum autofluorescence for individual RPE cells were measured (cellular autofluorescence [CAF]). MAIN OUTCOME MEASURES: Statistically significant differences in intensity and localization of HAF and CAF at defined stages of RPE morphologic progression for GA and control eyes. RESULTS: The RPE morphologic features were most abnormal (cell rounding, sloughing, and layering; grade 2) and HAF intensity profiles were highest and most variable immediately adjacent to atrophic areas. Peaks in HAF intensity frequently were associated with vertically superimposed cells. The HAF value that optimally separated reactive RPE was 0.66 standard deviations more than the mean for uninvolved RPE and was associated with a sensitivity of 75.8% and a specificity of 76.3%. When variable cell area was accounted for, neither mean nor sum CAF differed significantly among the RPE pathologic grades. CONCLUSIONS: Areas with advanced RPE alterations are most likely to exhibit clinically recognizable patterns of elevated FAF around GA, but may not predict cells about to die, because of vertically superimposed cells and cellular fragments. These data do not support a role for lipofuscin-related cell death and call into question the rationale of treatments targeting lipofuscin.
Change in prostaglandin expression levels and synthesizing activities in dry eye disease.
Shim J, Park C, Lee HS … +6 more , Park MS, Lim HT, Chauhan S, Dana R, Lee H, Lee HK
Ophthalmology · 2012 Nov · PMID 22858125 · Full text
OBJECTIVE: To investigate the expression level of prostaglandins (PGs) and their de novo synthesis in dry eye (DE) disease. DESIGN: Cross-sectional case-control study and in vivo mouse experimental study. PARTICIPANTS: F...
OBJECTIVE: To investigate the expression level of prostaglandins (PGs) and their de novo synthesis in dry eye (DE) disease. DESIGN: Cross-sectional case-control study and in vivo mouse experimental study. PARTICIPANTS: Forty-six eyes from 23 DE patients and 33 eyes from 17 age- and sex-matched controls were studied. Also, DE-induced murine eyes were compared with control eyes. METHODS: Patients completed a symptom questionnaire using a 100-mm visual analog scale (VAS). Nano-liquid chromatography tandem mass spectrometry was used for the quantification of PGE2 and PGD2. A DE disease environmental chamber was used to induce DE in mice. One week after induction, enzyme expressions of cyclooxygenase-1, cyclooxygenase-2 (COX-2), PG E synthase (PGES), and PG D synthase (PGDS) in the lacrimal glands, meibomian glands, and corneas were examined using immunohistochemistry and quantitative real-time polymerase chain reaction (qRT-PCR). MAIN OUTCOME MEASURES: The mean PGE2 and PGD2 levels in the tears of DE patients were measured and compared with symptom severity scores. Immunohistochemistry staining patterns and qRT-PCR data of DE mice were quantified. RESULTS: The mean PGE2 level in the tears of DE patients (2.72 ±3 .42 ng/ml) was significantly higher than that in the control group (0.88 ± 0.83 ng/ml; P = 0.003). However, the mean PGD2 level in the tears of DE patients (0.11 ± 0.22 ng/ml) was significantly lower (0.91 ± 3.28 ng/ml; P = 0.028). The mean PGE2-to-PGD2 ratio correlated strongly with VAS scoring (P = 0.008). In DE mice, COX-2 mRNA was significantly higher in ocular surface tissue and lacrimal glands. Furthermore, PGES mRNA was significantly higher in ocular surface tissue, whereas PGDS mRNA was decreased. Immunohistochemistry staining showed elevated COX-2 expression in the lacrimal glands, meibomian glands, corneas, and conjunctivas. Furthermore, PGES expression was found in periductal infiltrated cells of the lacrimal glands and conjunctival epithelium. Also, PGDS expression was decreased in meibomian glands and increased focally in the conjunctival epithelium. CONCLUSIONS: A reciprocal change in PGE2 and PGD2 levels was found in the tears of DE patients, which correlated with patients' symptom scores. These clinical results were supported by increased COX-2 and PGES expression levels found in tear-producing tissues of DE mice.
Patterns of peripapillary retinal nerve fiber layer thinning in vigabatrin-exposed individuals.
Clayton LM, Devile M, Punte T … +4 more , de Haan GJ, Sander JW, Acheson JF, Sisodiya SM
Ophthalmology · 2012 Oct · PMID 22853973 · Publisher ↗
PURPOSE: To explore the relationship of peripapillary retinal nerve fiber layer (ppRNFL) thinning in individuals exposed to the antiepileptic drug vigabatrin with respect to 2 separate variables: cumulative vigabatrin ex...
PURPOSE: To explore the relationship of peripapillary retinal nerve fiber layer (ppRNFL) thinning in individuals exposed to the antiepileptic drug vigabatrin with respect to 2 separate variables: cumulative vigabatrin exposure and severity of vigabatrin-associated visual field loss (VAVFL). DESIGN: Cross-sectional observational study. PARTICIPANTS: Subjects were older than 18 years, 129 with vigabatrin-treated epilepsy (vigabatrin-exposed group) and 87 individuals with epilepsy never treated with vigabatrin (nonexposed group). METHODS: All subjects underwent ppRNFL imaging using spectral-domain optical coherence tomography. Eighty-four vigabatrin-exposed individuals underwent Goldmann kinetic perimetry. The visual field examined from the right eye was categorized as normal (n = 47), mildly abnormal (n = 18), or moderately to severely abnormal (n = 19). In 91 vigabatrin-exposed individuals, the cumulative vigabatrin exposure could be ascertained: 41 subjects received 1000 g or less, 23 subjects received more than 1000 g but equal to or less than 2500 g, 16 subjects received more than 2500 g but equal to or less than 5000 g or less, and 11 subjects received more than 5000 g. MAIN OUTCOME MEASURES: Differences in ppRNFL thickness across the twelve 30° sectors: (1) among all nonexposed individuals and all vigabatrin-exposed individuals, (2) between each vigabatrin-exposed group, according to cumulative vigabatrin exposure, and the nonexposed group, (3) among different vigabatrin-exposed subjects grouped according to cumulative vigabatrin exposure, and (4) among vigabatrin-exposed subjects grouped according to severity of VAVFL. RESULTS: The ppRNFL was significantly thinner in vigabatrin-exposed compared with nonexposed individuals in most 30° sectors (P<0.004). The temporal, temporal superior, and temporal inferior 30° sectors, as well as the nasal 30° sector, were not affected. There was a trend for increasing ppRNFL thinning with increasing cumulative vigabatrin exposure. The nasal-superior 30° sector was significantly thinner in group 1 (≤1000 g) compared with nonexposed individuals (P<0.05) and in vigabatrin-exposed individuals with normal visual fields compared with nonexposed individuals (P<0.05). CONCLUSIONS: After vigabatrin exposure in individuals receiving cumulative doses of 1000 g or less or in the presence of normal visual fields, ppRNFL thinning in the nasal superior 30° sector may occur. With higher cumulative doses of vigabatrin exposure, additional ppRNFL thinning was observed. The temporal aspects of the ppRNFL are spared, even in individuals with large cumulative vigabatrin exposures and moderate or severe VAVFL.
Evaluation of intraocular reactivity to metallic and ethylene oxide contaminants of medical devices in a rabbit model.
Calogero D, Buchen SY, Tarver ME … +3 more , Hilmantel G, Lucas AD, Eydelman MB
Ophthalmology · 2012 Jul · PMID 22578444 · Publisher ↗
OBJECTIVE: To evaluate the intraocular reactivity to metallic and ethylene oxide (EO) contaminants of ophthalmic devices in rabbits. DESIGN: Two experimental animal studies. PARTICIPANTS: Thirty-five New Zealand white ra...
OBJECTIVE: To evaluate the intraocular reactivity to metallic and ethylene oxide (EO) contaminants of ophthalmic devices in rabbits. DESIGN: Two experimental animal studies. PARTICIPANTS: Thirty-five New Zealand white rabbits. METHODS: A metallic exposure study and an EO exposure study were performed. In the first study, both eyes of 25 rabbits were equally allocated to intracameral injections of alumina 0.2 μg, alumina 20 μg, copper sulfate 0.4 μg, copper sulfate 20 μg, or an aqueous control. In the second study, 10 rabbits were allocated (5 per group) to receive intracamerally an ophthalmic viscosurgical device (OVD) exposed to EO or not exposed to EO (control). All eyes were examined by slit lamp at baseline and 3, 6, 9, 24, 48, and 72 hours after exposure, with dilated indirect ophthalmoscopy being performed at 24 and 72 hours. Tonometry was performed only in the first study. MAIN OUTCOME MEASURES: Grade of corneal clouding, anterior chamber (AC) flare, AC cells, AC fibrin, iridal hyperemia, cell and fibrin on the lens surface, vitreous haze and cells, lens opacities, intraocular pressure, and onset time. RESULTS: For metallic compounds at the study's low doses, mean inflammatory grades were 0.2 or less above the control for all responses at all time points. For the high-dose alumina, mean inflammatory grades peaked at 6 to 9 hours at 0.5 to 0.7 above the control responses for conjunctival congestion, iris hyperemia, AC cells, flare, and fibrin and declined over the remaining time points. For the high-dose copper sulfate, mean inflammatory grades peaked between 3 and 24 hours at 1.2 to 1.8 above the control responses for conjunctival congestion, iris hyperemia, AC cells, flare, fibrin, and corneal clouding, then subsequently declined. The intraocular pressure changes appeared significant for only high-dose copper sulfate, with mean declines of 4.3 to 7.5 mmHg at 6 to 72 hours. No clinically meaningful differences in ocular inflammation were observed between the OVD exposed to EO and the OVD not exposed to EO. CONCLUSIONS: Alumina and copper sulfate did not cause clinically meaningful ocular inflammation at the low study levels (levels expected with ophthalmic devices). Ethylene oxide exposure of an OVD was not associated with inflammation.
Pathologic epithelial and anterior corneal nerve morphology in early-stage congenital aniridic keratopathy.
Edén U, Fagerholm P, Danyali R … +1 more , Lagali N
Ophthalmology · 2012 Sep · PMID 22512983 · Publisher ↗
OBJECTIVE: To document the clinical and morphologic corneal findings in the early stages of congenital aniridic keratopathy in Swedish families. DESIGN: Prospective, observational, comparative case series. PARTICIPANTS:...
OBJECTIVE: To document the clinical and morphologic corneal findings in the early stages of congenital aniridic keratopathy in Swedish families. DESIGN: Prospective, observational, comparative case series. PARTICIPANTS: A total of 16 eyes of 16 subjects with congenital aniridic keratopathy and a clear central cornea, and 6 eyes from 6 healthy controls (unaffected relatives). Nine of the 16 eyes with aniridia came from 5 families with a documented familial history of aniridia. METHODS: Detailed ophthalmic examinations included best spectacle-corrected visual acuity (BSCVA), tear film production, tear break-up time (BUT), corneal touch sensitivity, intraocular pressure measurement, ultrasound pachymetry, slit-lamp biomicroscopy, and laser scanning in vivo confocal microscopy (IVCM). MAIN OUTCOME MEASURES: Confirmed stage of aniridic keratopathy, clinical parameters of cornea and tear film (visual acuity, sensitivity, corneal thickness, tear production, and BUT), and the morphologic status of corneal epithelium, sub-basal nerves, and limbal palisades of Vogt. RESULTS: In early-stage aniridic keratopathy, BSCVA and tear BUT were reduced relative to controls (P < 0.001 for both), and corneal thickness was increased (P=0.01). Inflammatory dendritic cells were present in the central epithelium in aniridia, with significantly increased density relative to controls (P = 0.001). Discrete focal opacities in the basal epithelial region were present in 5 of 11 aniridia cases with an otherwise clear cornea. Opacities were associated with dendritic cells and harbored structures presumed to be goblet cells. Sub-basal nerves were extremely dense in 3 aniridia cases, and a prominent whorl pattern of nerves and epithelial cells was observed in 1 case. Normal limbal palisade morphology was absent in aniridia but present in controls. CONCLUSIONS: Early-stage aniridic keratopathy is characterized by the development of focal opacities in the basal epithelium, altered sub-basal nerves, infiltration of the central epithelium by dendritic cells, tear film instability, and increased corneal thickness and degradation of limbal palisade architecture. These findings may help to elucidate the pathogenesis of aniridic keratopathy.
New strategy for rapid diagnosis and characterization of keratomycosis.
Goldschmidt P, Degorge S, Benallaoua D … +7 more , Semoun O, Borsali E, Le Bouter A, Batellier L, Borderie V, Laroche L, Chaumeil C
Ophthalmology · 2012 May · PMID 22342013 · Publisher ↗
PURPOSE: The first-line therapy for patients with keratitis is different for bacteria, filamentous fungi, and yeasts. The timely onset of treatments depends on rapid and accurate diagnosis. However, fungal cultures produ...
PURPOSE: The first-line therapy for patients with keratitis is different for bacteria, filamentous fungi, and yeasts. The timely onset of treatments depends on rapid and accurate diagnosis. However, fungal cultures produce high rates of false-negative results. Nucleic acid amplification techniques (polymerase chain reaction [PCR]) improve fungal diagnosis performance, but they require complex postamplification procedures to differentiate filamentous fungi from yeasts or to identify the agent. The objective of this work was to develop a new diagnostic strategy based on real-time PCR high-resolution melting (HRM) analysis that in 1 run (a) detects and semiquantifies yeasts and filamentous fungi, (b) differentiates yeasts from filamentous fungi, and (c) discriminates among relevant species of yeasts. DESIGN: Experimental study to compare HRM diagnosis performances with microscopic examination of corneal scrapings and fungal culture. PARTICIPANTS AND CONTROLS: High-resolution melting detection limits and specificity were assessed with (a) isolated strains; (b) agents (other than fungi) producing keratitis; (c) corneal scrapings from fungal keratitis (culture positive and negative); and (d) corneal scrapings from bacterial, viral, or Acanthamoeba keratitis. METHODS: The DNA extracted from cornea specimens was mixed with primers diluted in the MeltDoctor HRM Master Mix (Applied Biosystems, Paris, France) in 2 tubes, the first for yeasts, containing the forward primer CandUn (5'CATGCCTGTTTGAGCGTC) and the reverse primer FungUn2 (5'TCCTCCGCTTATTGATATGCT), and the second for filamentous fungi, containing the forward primer FilamUn1 (5'TGCCTGTCCGAGCGTCAT) and FungUn2. Molecular probes were not necessary. The yields of DNA extraction and the PCR inhibitors were monitored by adding internal controls to each sample. MAIN OUTCOME MEASURES: Detection of fungi in corneal samples by HRM. RESULTS: High-resolution melting consistently detects the equivalent of 0.1 colony-forming units /ml of yeasts and filamentous fungi, differentiates filamentous fungi from yeasts, and discriminates among relevant species of yeasts. High-resolution melting sensitivity and specificity were 100% for culture-positive samples, detecting and characterizing fungi in 7 of 10 culture-negative suspected fungal keratitis. CONCLUSIONS: High-resolution melting is a new, sensitive, specific, and inexpensive test that detects fungi and differentiates filamentous fungi from yeasts directly from clinical specimens in less than 2.30 hours after DNA extraction.
Clinical outcome and recurrence of epithelial basement membrane dystrophy after phototherapeutic keratectomy a cross-sectional study.
Germundsson J, Fagerholm P, Lagali N
Ophthalmology · 2011 Mar · PMID 20869120 · Publisher ↗
OBJECTIVE: To evaluate the outcome of phototherapeutic keratectomy (PTK) treatment of epithelial basement membrane dystrophy (EBMD) patients and to examine clinical and morphologic signs of recurrent dystrophy. DESIGN: C...
OBJECTIVE: To evaluate the outcome of phototherapeutic keratectomy (PTK) treatment of epithelial basement membrane dystrophy (EBMD) patients and to examine clinical and morphologic signs of recurrent dystrophy. DESIGN: Cross-sectional, clinic-based study. PARTICIPANTS: Fifty-two eyes of 39 patients diagnosed with EBMD who underwent PTK between 2001 and 2008. METHODS: Preoperative symptoms, best spectacle-corrected visual acuity (BSCVA), and refraction data were collected. At follow-up, refraction and BSCVA were measured, symptoms were noted, and slit-lamp biomicroscopy and in vivo confocal microscopy (IVCM) were performed. MAIN OUTCOME MEASURES: Best spectacle-corrected visual acuity and signs of recurrent EBMD based on symptoms and morphologic features. An assessment of EBMD severity after PTK additionally was considered. RESULTS: Mean follow-up time was 43 months (range, 7-100 months). After PTK, BSCVA remained unchanged or improved in 49 (98%) of 51 eyes. Twenty-four (46%) of 52 eyes had recurrence of some form, and recurrence was correlated positively with postoperative time (P<0.001). Symptomatic recurrence occurred in 7 eyes (13%), whereas morphologic recurrence occurred in 21 eyes (40%). Symptoms were coupled with positive IVCM findings in 3 (43%) of 7 cases and with slit-lamp findings in 1 (14%) of 7 cases. Of 17 eyes with morphologic recurrence by IVCM, 9 eyes (53%) were classified as having grade 1 recurrence, 8 eyes (47%) were classified as having grade 2 recurrence, and none were classified as having grade 3 recurrence. Morphologic recurrence was associated with epithelial removal by laser ablation before PTK. CONCLUSIONS: Although PTK is an effective method of alleviating the clinical symptoms of EBMD, the dystrophy can recur with time. The relationship between the postoperative development of clinical symptoms and the corneal morphologic features is complex and requires further investigation.
Doxycycline's effect on ocular angiogenesis: an in vivo analysis.
Cox CA, Amaral J, Salloum R … +9 more , Guedez L, Reid TW, Jaworski C, John-Aryankalayil M, Freedman KA, Campos MM, Martinez A, Becerra SP, Carper DA
Ophthalmology · 2010 Sep · PMID 20605212 · Full text
PURPOSE: To determine the in vivo effect of doxycycline on choroidal angiogenesis and pterygium growth by using a choroidal neovascular (CNV) murine model, a directed in vivo angiogenesis assay (DIVAA) and a pterygium mu...
PURPOSE: To determine the in vivo effect of doxycycline on choroidal angiogenesis and pterygium growth by using a choroidal neovascular (CNV) murine model, a directed in vivo angiogenesis assay (DIVAA) and a pterygium murine model. DESIGN: Experimental study. PARTICIPANTS: Three murine models were investigated with 4 mice minimum per group and 22 maximum per group. METHODS: Mice received water with or without doxycycline. For the CNV, the neovascular lesion volume was determined in choroid-retinal pigment epithelial flat mounts using confocal microscopy 7 days after laser induction. For DIVAA, silicone capsules containing 10,000 human pterygium epithelial cells were implanted in the flanks of mice subcutaneously. After 11 days, neovascularization (NV) was quantified using spectrofluorometry after murine tail-vein injection of fluorescein isothiocyanate-labeled dextran. A pterygium epithelial cell model was developed by injecting 10,000 human pterygium epithelial cells in the nasal subconjunctival space in athymic nude mice. Doxycycline was started on day 6 at 50 mg/kg per day; corneal lesions that resulted from the injections were compared at days 6 and 15. MAIN OUTCOME MEASURES: The Student t-test was used to evaluate the data for the CNV and DIVAA models and histologic preparations were used to evaluate pterygia lesions. RESULTS: There was significantly less NV and lesion volume with doxycycline taken in drinking water versus plain water. With doxycycline treatment, the laser-induced CNV showed a maximal 66% decrease in choroidal blood vessel volume (P< or =0.008) and the DIVAA showed a 30% reduction of blood vessel growth and migration (P<0.004). Histologic preparations demonstrated that pterygium cell lesions regressed when mice were administered doxycycline for 9 days. CONCLUSIONS: Doxycycline significantly inhibited angiogenesis in 3 murine models. The most dramatic effect was found in the CNV model followed by the pterygia epithelial cell DIVAA model. The anterior segment pterygium model also showed regression histologically. This suggests that doxycycline may be successful as an adjunctive treatment for CNV and pterygia in humans; clinical trials would be necessary to determine if there is a benefit.
Increased tissue endothelin-1 and endothelin-B receptor expression in temporal arteries from patients with giant cell arteritis.
Dimitrijevic I, Andersson C, Rissler P … +1 more , Edvinsson L
Ophthalmology · 2010 Mar · PMID 20036012 · Publisher ↗
PURPOSE: Endothelin (ET)-1 has been implicated in the atherosclerotic process and during inflammation. Similarity in the development process of giant cell arteritis (GCA) and atherosclerosis exists. Several ET receptor a...
PURPOSE: Endothelin (ET)-1 has been implicated in the atherosclerotic process and during inflammation. Similarity in the development process of giant cell arteritis (GCA) and atherosclerosis exists. Several ET receptor antagonists have been developed, principally to target cardiovascular disease states. High doses of corticosteroids currently are used in the treatment of GCA, whereas other treatments are not as reliably effective. The present study was performed to elucidate the role for ET-1, ET(A), and ET(B) receptors in GCA. DESIGN: Experimental, retrospective immunohistochemical study of temporal arteries using archival formalin-fixed, paraffin-embedded tissue. PARTICIPANTS: The study included 10 patients with GCA and 10 control patients with clinically suspected GCA but diagnosed not to have GCA. METHODS: Immunohistochemistry, with anti ET-1, anti-ET(A), and anti-ET(B) antibodies, was performed on formalin-fixed and paraffin-embedded temporal arteries. MAIN OUTCOME MEASURES: Endothelin-1, ET(A), and ET(B) receptor immunostaining intensities were quantified. RESULTS: Temporal arteries from the patients with GCA showed the typical histologic features, including intimal thickening, disruption or loss of the elastic lamina, and inflammatory infiltrates of lymphocytes, macrophages, and multinucleated giant cells. These features were associated with increased ET-1 and ET(B) receptor immunoreactivity in the medial layer of the temporal arteries and endothelial cells in patients with GCA compared with the controls. The increased ET-1 and ET(B) receptor immunoreactivity occurred in vascular smooth muscle cells (SMCs) and multinucleated giant cells. The ET-1 and ET(B) receptor immunoreactivity correlated with the degree of systemic inflammation. No changes were observed in ET(A) receptor expression in SMCs or endothelial cells compared with controls. CONCLUSIONS: The results suggest a role for ET-1 and ET(B) receptors in GCA. Inhibiting the ET system may provide a corticosteroid-sparing alternative in the treatment of GCA.
Detection of bacterial endosymbionts in clinical acanthamoeba isolates.
Iovieno A, Ledee DR, Miller D … +1 more , Alfonso EC
Ophthalmology · 2010 Mar · PMID 20031220 · Full text
PURPOSE: To determine the presence of 4 clinically relevant bacterial endosymbionts in Acanthamoeba isolates obtained from patients with Acanthamoeba keratitis (AK) and the possible contribution of endosymbionts to the p...
PURPOSE: To determine the presence of 4 clinically relevant bacterial endosymbionts in Acanthamoeba isolates obtained from patients with Acanthamoeba keratitis (AK) and the possible contribution of endosymbionts to the pathogenesis of AK. DESIGN: Experimental study. PARTICIPANTS: Acanthamoeba isolates (N = 37) recovered from the cornea and contact lens paraphernalia of 23 patients with culture-proven AK and 1 environmental isolate. METHODS: Acanthamoeba isolates were evaluated for the presence of microbial endosymbionts belonging to the bacterial genera Legionella, Pseudomonas, Mycobacterium, and Chlamydia using molecular techniques (polymerase chain reaction and sequence analysis, fluorescence in situ hybridization) and transmission electron microscopy. Corneal toxicity and virulence of Acanthamoeba isolates with and without endosymbionts were compared using a cytopathic effect (CPE) assay on human corneal epithelial cells in vitro. Initial visual acuity, location and characteristics of the infiltrate, time to detection of the infection, and symptom duration at presentation were evaluated in all patients. MAIN OUTCOME MEASURES: Prevalence and potential pathobiology of bacterial endosymbionts detected in Acanthamoeba isolates recovered from AK. RESULTS: Twenty-two (59.4%) of the 38 cultures examined contained at least 1 bacterial endosymbiont. One isolate contained 2 endosymbionts, Legionella and Chlamydia, confirmed by fluorescence in situ hybridization. Corneal toxicity (CPE) was significantly higher for Acanthamoeba-hosting endosymbionts compared with isolates without endosymbionts (P<0.05). Corneal pathogenic endosymbionts such as Pseudomonas and Mycobacterium enhanced Acanthamoeba CPE significantly more than Legionella (P<0.05). In the presence of bacterial endosymbionts, there was a trend toward worse initial visual acuity (P>0.05), central location (P<0.05), absence of radial perineuritis (P<0.05), delayed time to detection (P>0.05), and longer symptom duration at presentation (P>0.05). CONCLUSIONS: Most Acanthamoeba isolates responsible for AK harbor 1 or more bacterial endosymbionts. The presence of endosymbionts enhances the corneal pathogenicity of Acanthamoeba isolates and may impact detection time and clinical features of AK.
About
- Frequency
- Sun
- Papers found
- 200
- RSS feed
- Subscribe